1
–
15
of
5,100
results

Content And Storage | −20°C for one year from date of shipment |
---|---|
Host Species | Rabbit |
Applications | ChIP Assay,ChIP sequencing (ChIP-seq),Western Blot |
Form | Purified |
Gene Accession No. | Q66I33 |
Isotype | IgG |
Includes | Trimethyl-Histone H3 (Lys4) ChIP validated Antibody and Primer set including the ChIP-grade antibody and the specific control PCR primers used for chromatin immunoprecipitation of H3K4Me3. |
Antigen | Trimethyl-Histone H3 (Lys4)α |
Regulatory Status | RUO |
Gene Symbols | H3F3A, H3F3B, H3F3 |
Gene ID (Entrez) | NM_003493 |
Formulation | Anti-Trimethyl-Histone H3 (Lys4) recombin-ant rabbit monoclonal IgG. One vial containing 75μL of protein A purified rabbit IgG in storage buffer (0.1M Tris-Glycine pH 7.4, 0.15M NaCl, 0.05% NaN3, with the addition of 40% glycerol. Normal Rabbit IgG. One vial containing 75μL of normal rabbit IgG. Control Primers. One vial containing 75μL of 5μM of each primer specific for human GAPDH. FOR: TAC TAG CGG TTT TAC GGG CG REV: TCG AAC AGG AGG AGC AGA GAG CGA |
Immunogen | The trimethyl-histone H3 (Lys4) antibody is made against a BSA-conjugated,synthetic peptide containing the sequence …RT[me3K]QT… in which me3K corresponds to trimethyl-lysine 4 of human histone H3 |
Classification | Monoclonal |
Primary or Secondary | Primary |
Test Specificity | Trimethyl-Histone H3 (Lys4) |
Content And Storage | −20°C for one year |
---|---|
Host Species | Rabbit |
Applications | ChIP Assay,Western Blot |
Form | Purified |
Gene Accession No. | Q16695 |
Includes | Trimethyl-Histone H3 (Lys27) ChIP validated Antibody and Primer set including the ChIP-grade antibody and the specific control PCR primers used for chromatin immunoprecipitation of H3K27Me3. |
Antigen | Trimethyl-Histone H3 (Lys27) |
Regulatory Status | RUO |
Gene Symbols | H3F3A, MGC87783, H3.3A, MGC87782, H3F3, H3.3B, H3F3B |
Gene ID (Entrez) | NP_003484 |
Formulation | Anti-trimethyl-Histone H3 (Lys27) (rabbit polyclonal IgG). One vial containing 100μg protein A purified IgG in 100μL buffer containing 0.1 M Tris-Glycine, pH 7.4, 0.15M NaCl with 0.05% sodium azide. Normal Rabbit IgG. One vial containing 125μg purified Rabbit IgG in 125μL storage buffer containing 0.1% sodium azide. ChIP Primers human alpha-Satellite. One vial containing 75μL of 5μM of each control primer specific for human alpha-Satellite. FOR: CTG CAC TAC CTG AAG AGG AC; REV: GAT GGT TCA ACA CTC TTA CA |
Immunogen | KLH-conjugated,synthetic 2X-branched peptide containing the sequence ...AR(me3K)SAP... in which me3K corresponds to trimethyl-lysine at residue 27 of human Histone H3. |
Classification | Polyclonal |
Primary or Secondary | Primary |
Test Specificity | trimethyl-Histone H3 (Lys27) |
MilliporeSigma™ Upstate™ EEDα, Mouse monoclonal, ChIP Validated Antibody and Primer Set
Mouse Monoclonal Antibody
Content And Storage | -20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles |
---|---|
Host Species | Mouse |
Applications | ChIP Assay,Western Blot |
Form | Purified |
Gene Accession No. | O75530 |
Isotype | IgG2a κ |
Includes | This ChIPAb+ EED -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers. |
Antigen | EEDα |
Regulatory Status | RUO |
Gene Symbols | EED; WAIT-1 |
Gene ID (Entrez) | NP_003788 |
Formulation | Anti-EED (Mouse monoclonal IgG). One vial containing 50μg of protein G purified antibody in 0.1 M Tris-Glycine (pH 7.4) 150mM NaCl, containing 0.05% azide. May contain 30% glycerol (see certificate of analysis for details). Normal mouse IgG. Two vials containing 25μg of purified mouse IgG in 25μL of storage buffer containing 0.1% sodium azide. ChIP Primers, HoxA2 upstream. One vial containing 75μL of 5μM of each primer specific for the promoter region of human HoxA2. FOR: AGG AAA GAT TTT GGT TGG GAA G; REV: AAA AAG AGG GAA AGG GAC AGA C |
Immunogen | Recombinant fusion protein of full length murine EED tagged with MBP. |
Classification | Monoclonal |
Primary or Secondary | Primary |
Test Specificity | Recognizes EED, MW: ∽50kDa. |
MilliporeSigmaâ„¢ Upstateâ„¢ Acetyl-Histone H4, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set
Rabbit Polyclonal Antibody
Content And Storage | −20°C from date of receipt |
---|---|
Host Species | Rabbit |
Applications | Multiplex,Functional Assay,Immunoassay,Western Blot |
Form | Serum |
Gene Accession No. | P62805 |
Includes | This ChIPAb+ Acetyl-Histone H4 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers. |
Antigen | Acetyl-Histone H4 |
Regulatory Status | RUO |
Gene ID (Entrez) | NP_778224 |
Formulation | Anti-Acetyl-Histone H4 (rabbit polyclonal IgG). One vial containing 100μL of antiserum containing 0.05% sodium azide. Normal Rabbit Serum. One vial containing 100μL antiserum containing 0.05% sodium azide. Control Primers. One vial containing 75μL of 5μM of each primer specific for for human GAPDH. |
Immunogen | The acetyl-histone H4 antiserum is made against a peptide corresponding to amino acids 2-19 of Tetrahymena histone H4. |
Classification | Polyclonal |
Primary or Secondary | Primary |
Test Specificity | Recognizes acetylated histone H4 of approximately 10kDa. Cross-reacts with acetylated histone H2B from Tetrahymena and weakly crossreacts with acetylated histone H2B from HeLa cells. May cross-react with other acetylated proteins. |
Content And Storage | -20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles |
---|---|
Host Species | Rabbit |
Applications | ChIP Assay,Western Blot |
Gene Accession No. | P62805 |
Includes | This ChIPAb+ Monomethyl-Histone H4 (Lys20) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers. |
Antigen | Monomethyl-Histone H4 (Lys20) |
Regulatory Status | RUO |
Gene Symbols | H4/A , H4/B, H4/C , H4/D, H4/E, H4/G, H4/H, H4/I, H4/J, H4/J, H4/M, H4/N, H4/O , H4/a , H4F2, H4FA , H4FB , H4FC , H4FD, H4FE, H4FG, H4FH, H4FI , H4FJ, H4FK, H4FM , H4FN, H4FO, HIST2H4 |
Purification Method | Affinity Purified |
Gene ID (Entrez) | NM_003538.3 |
Formulation | Anti-monomethyl-Histone H4 (Lys20) (rabbit polyclonal IgG). One vial containing 100μg of affinity purified antibody in 100μL 0.1M Tris-Glycine (pH 7.4), 15mM NaCl, and 0.05% NaN3. Normal Rabbit IgG. One vial containing 125μg of purified rabbit IgG in 125μL storage buffer. ChIP Primers GAPDH Coding Region. One vial containing 75μL of 5μM of each primer specific for human GAPDH coding region. FOR: GGC TCC CAC CTT TCT CAT CC; REV: GGC CAT CCA CAG TCT TCT GG |
Immunogen | The immunogen was a synthetic peptide corresponding to amino acids 15-24 of histone H4,monomethylated on Lys20. |
Classification | Polyclonal |
Primary or Secondary | Primary |
Test Specificity | Recognizes histone H4, Mr ∽11kDa. |
MilliporeSigmaâ„¢ Upstate ChIPAb+ REST - ChIP Validated Antibody and Primer Set
REST purified antibody against GST fusion protein corresponding to amino acids 801-1097 of human REST
Antigen | Apolipoprotein E |
---|---|
Regulatory Status | RUO |
Content And Storage | −20°C |
Host Species | Goat |
Applications | ELISA,Immunoprecipitation |
Form | Diluted |
Formulation | In 500mM NaCl, 50mM Tris-HCl, pH 7.5. |
Immunogen | purified recombinant human apolipoprotein E |
Classification | Polyclonal |
Isotype | IgG |
Primary or Secondary | Primary |
Test Specificity | Recognizes human apolipoprotein E. Does not cross-react with other apolipoproteins. Antibody Target Gene Symbol: APOE Target Synonym: AD2, AI255918, APOE2, APOE4, APOEA, APOLIPOPROTEIN E, LDLCQ5, LPG, MGC1571 Entrez Gene Name: apolipoprotein E |
Content And Storage | -20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles |
---|---|
Host Species | Rabbit |
Applications | ChIP Assay,Dot Blot,Functional Assay,Western Blot |
Form | Purified |
Gene Accession No. | Q16695 |
Isotype | IgG |
Includes | This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers. |
Antigen | Trimethyl-Histone H3 (Lys36)α |
Regulatory Status | RUO |
Gene Symbols | H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945 |
Purification Method | Protein A purified |
Gene ID (Entrez) | NP_003484 |
Formulation | Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT |
Immunogen | KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36). |
Classification | Monoclonal |
Primary or Secondary | Primary |
Test Specificity | Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa. |
Content And Storage | -20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles |
---|---|
Host Species | Rabbit |
Applications | ChIP Assay,Immunoprecipitation,Western Blot |
Form | Serum |
Gene Accession No. | P62805 |
Includes | The ChIPAb+ Acetyl-Histone H4 (Lys8) set includes the Acetyl-Histone H4 (Lys8) antibody, a negative control rabbit serum and qPCR primers which amplify a 134bp region of human HSPCA. |
Antigen | Acetyl-Histone H4 (Lys8) |
Regulatory Status | RUO |
Gene Symbols | HIST1H4A, H4/J, HIST1H4F, HIST1H4L, H4FN, H4FA, H4FH, HIST1H4H, H4F2, H4FM, H4/A, H4FK, H4FG, HIST2H4, H4FB, H4/K, HIST1H4I, H4/N, HIST1H4B, H4FE, H4/M, H4/a, HIST1H4E, HIST4H4, HIST2H4A, H4FC, H4FI, H4/H, HIST1H4C, H4/G, HIST1H4K, H4FJ, H4FD, H4/I, H4/B, H4/D, H4/C, HIST1H4J, HIST1H4D, H4/E |
Purification Method | Unpurified |
Gene ID (Entrez) | NM_175054 |
Formulation | Anti-Acetyl-Histone H4 (Lys8) (rabbit polyclonal). One vial containing 50μL of antiserum containing 0.05% sodium azide. Normal Rabbit Serum. One vial containing 100μL of antiserum containing 0.05% sodium azide. ChIP Primers, HSPCA. One vial containing 75μL of 5μM of each primer specific for human HSPCA. FOR: GCA ACA GCT ACC ACA GGA CCA; REV: GAG CGT GTG AAA TCA ACA TAA AGC |
Immunogen | Synthetic peptide corresponding to yeast Histone H4 acetylated at lysine 8. |
Classification | Polyclonal |
Primary or Secondary | Primary |
Test Specificity | Recognizes acetyl-Histone H4 (Lys8). |
MilliporeSigma™ Upstate™ E2F-1α, Mouse monoclonal, ChIP Validated Antibody and Primer Set
Mouse Monoclonal Antibody
Content And Storage | -20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles |
---|---|
Host Species | Mouse |
Applications | ChIP Assay,ChIP sequencing (ChIP-seq),Immunoprecipitation |
Form | Purified |
Gene Accession No. | Q01094 |
Isotype | IgG |
Includes | This ChIPAb+ E2F-1 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers. |
Antigen | E2F-1α |
Regulatory Status | RUO |
Gene Symbols | E2F1, RBAP-1, E2F-1, RBP3, RBBP3, RBBP-3, PBR3 |
Purification Method | Protein G purified |
Gene ID (Entrez) | NP_005216 |
Formulation | Anti-E2F-1 (mouse monoclonal). One vial containing 25μg of protein G purified monoclonal mixed IgG in 25μL of buffer containing 0.1 M Tris-glycine, pH 7.4, 0.15 M NaCl with 0.05% sodium azide. Frozen solution. Nornal Mouse IgG. One vial containing 25μg of purified IgG in 25μL of storage buffer containing 0.1% sodium azide. ChIP Primers, CDC2 promoter. One vial containing 75μL of 5μM each primer specific for human CDC2 promoter. FOR: CGC CCT TTC CTC TTT CTT TC; REV: ATC GGG TAG CCC GTA GAC TT |
Immunogen | GST fusion protein corresponding to full-length human E2F-1. |
Classification | Monoclonal |
Primary or Secondary | Primary |
Test Specificity | The epitopes have been mapped to amino acids 1 to 89 and to amino acids 342 to 386. |
MilliporeSigmaâ„¢ Upstateâ„¢ HDAC3 Mouse monoclonal, ChIP Validated Antibody and Primer Set
Mouse Monoclonal Antibody
Content And Storage | -20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles |
---|---|
Host Species | Mouse |
Applications | ChIP Assay,Western Blot |
Form | Purified |
Gene Accession No. | O15379 |
Isotype | IgG2a |
Includes | This ChIPAb+ HDAC3 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers. |
Antigen | HDAC3 |
Regulatory Status | RUO |
Gene Symbols | HDAC3, SMAP45, HD3, RPD3, RPD3-2 |
Gene ID (Entrez) | NM_003883 |
Formulation | Anti-HDAC3 (mouse monoclonal). One vial containing 100μg of protein G purified monoclonal in buffer containing 0.02M phosphate buffer (pH 7.6), 0.25M NaCl, 0.1% sodium azide and 30% glycerol. Concentration: 1mg/mL. Normal Mouse IgG. One vial containing 125μg of purified mouse IgG in 125μL of storage buffer containing 0.1% sodium azide. ChIP Primers, p21. One vial containing 75μL of each primer (5μM) specific for a region of the human p21 (WAF1/CIP1/CDKN1A) promoter. FOR: CCC ACA GCA GAG GAG AAA GAA; REV: CTG GAA ATC TCT GCC CAG ACA |
Immunogen | peptide (NEFYDGDHDNDKESDVEI) corresponding to amino acids 411-428 of human HDAC3 |
Classification | Monoclonal |
Primary or Secondary | Primary |
Content And Storage | -20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles |
---|---|
Host Species | Rabbit |
Applications | ChIP Assay,Immunohistochemistry,Immunoprecipitation,Western Blot |
Gene Accession No. | P10275 |
Includes | ChIPAb+ Androgen Receptor set includes the Androgen Receptor antibody, a Normal Rabbit IgG, and control primers, which amplify a 85bp region of the human prostate specific antigen (PSA) enhancer region. |
Antigen | Androgen Receptor- ChIP Validated |
Regulatory Status | RUO |
Gene Symbols | AR, DHTR, SMAX1, HUMARA, KD, SBMA, TFM, OTTHUMP00000061928, AIS, NR3C4 |
Purification Method | Affinity Purified |
Gene ID (Entrez) | NP_000035 |
Formulation | Anti-Androgen Receptor (Rabbit Polyclonal). One vial containing 125μL (0.2μg/μL) purified rabbit polyclonal in buffer containing 0.1M Tris-Glycine (pH 7.4), 150mM NaCl, and 0.05% sodium azide, before the addition of 30% glycerol. Normal Rabbit IgG. One vial containing 125μg (1.0μg/μL) Rabbit IgG in 125μL storage buffer containing 0.05% sodium azide. ChIP Primers, PSA. One vial containing 75μL of 5μM of each primer specific for human prostate-specific antigen enhancer region. (chr19:51354179+51354263, hg19 build) FOR: 5’ GCC TGG ATC TGA GAG AGA TAT CAT C 3’; REV: 5’ ACA CCT TTT TTT TTC TGG ATT GTT G 3’ |
Immunogen | Peptide corresponding to amino acids 1-21 of the Human Androgen Receptor (MEVQLGLGRVYPRPPSKTYRG) |
Classification | Polyclonal |
Primary or Secondary | Primary |
Test Specificity | Recognizes Androgen Receptor. No cross-reactivity with estrogen, progesterone or glucocorticoid receptors. |
MilliporeSigmaâ„¢ anti-Amyloid Precursor Protein, C-Terminal (751-770), Polyclonal
Rabbit Polyclonal Antibody
Antigen | Amyloid Precursor Protein, C-Terminal (751-770) |
---|---|
Regulatory Status | RUO |
Content And Storage | −20°C |
Host Species | Rabbit |
Applications | Immunofluorescence,Immunohistochemistry,Immunoprecipitation |
Form | Undiluted |
Immunogen | a synthetic peptide [(C)KMQQNGYENPTYKFFEQMQN] corresponding to amino acids 751-770 of human precursor protein (APP),conjugated to KLH |
Classification | Polyclonal |
Isotype | IgG |
Primary or Secondary | Primary |
Test Specificity | Recognizes full-length APP and C-terminal soluble products CTFγ (∽6kDa), CTFα (∽9kDa), and CTFβ (∽11kDa). Antibody Target Gene Symbol: APP Target Synonym: AAA, AD1, Adap, AL024401, Amyloid precursor, Amyloidogenic glycoprotein, APP isoform 1, APPI, appican, CTFgamma, CVAP, E030013M08RIK, Nexin II, P3, PN2, PreA4, PROTEASE NEXIN2 Entrez Gene Name: amyloid beta (A4) precursor protein |
Antigen | Synapsin I |
---|---|
Regulatory Status | RUO |
Content And Storage | −20°C |
Host Species | Rabbit |
Applications | ELISA,Immunoblot,Immunoblot,Immunocytochemistry,Immunohistochemistry (Frozen),Immunoprecipitation |
Form | Undiluted |
Formulation | Undiluted serum. |
Immunogen | purified,bovine brain synapsin I |
Classification | Polyclonal |
Isotype | IgG |
Primary or Secondary | Primary |
Test Specificity | Recognizes the synapsin I protein in rat brain. |