accessibility menu, dialog, popup

UserName

Antibody Panels and Kits

Combinations of antibody-related products that may include sets of antibodies in pairs and cocktails, control particles, buffers, and other kits and panels; for use in specific applications such as immunoassays and T-cell activation.
Quantity 
  • (1)
  • (1)
  • (8)
  • (24)
  • (1)
  • (3)
  • (1)
  • (11)
  • (1)
  • (3)
  • (1)
  • (1)
  • (1)
  • (2)
Applications 
  • (10)
  • (2)
  • (8)
  • (2)
  • (10)
  • (2)
  • (1)
  • (7)
  • (3)
  • (2)
  • (28)
  • (2)
  • (36)
Classification 
  • (34)
  • (18)
Host Species 
  • (1)
  • (6)
  • (1)
  • (23)
  • (13)
  • (8)
Target Species 
  • (1)
  • (5)
  • (3)
  • (2)
  • (6)
  • (6)
  • (1)
  • (1)
  • (1)
  • (44)
  • (7)
  • (2)
  • (7)
  • (19)
  • (6)
  • (1)
  • (1)
  • (2)
  • (10)
  • (7)
  • (1)
  • (1)
  • (4)
  • (1)
  • (2)

Filtered Search Results

Products from some of our suppliers do not display in filtered search results. Please clear all filters to see these products.

Narrow Results

Narrow Results

category

brands

  • (15)
  • (37)
  • (7)
  • (16)

Quantity

  • (1)
  • (1)
  • (8)
  • (24)
  • (1)
  • (3)
  • (1)
  • (11)
  • (1)
  • (3)
  • (1)
  • (1)
  • (1)
  • (2)

Applications

  • (10)
  • (2)
  • (8)
  • (2)
  • (10)
  • (2)
  • (1)
  • (7)
  • (3)
  • (2)
  • (28)
  • (2)
  • (36)

Classification

  • (34)
  • (18)

Host Species

  • (1)
  • (6)
  • (1)
  • (23)
  • (13)
  • (8)

Target Species

  • (1)
  • (5)
  • (3)
  • (2)
  • (6)
  • (6)
  • (1)
  • (1)
  • (1)
  • (44)
  • (7)
  • (2)
  • (7)
  • (19)
  • (6)
  • (1)
  • (1)
  • (2)
  • (10)
  • (7)
  • (1)
  • (1)
  • (4)
  • (1)
  • (2)

Form

  • (2)
  • (1)
  • (1)
  • (7)
  • (28)
  • (2)

Isotype

  • (5)
  • (3)
  • (8)
  • (2)
  • (12)
  • (1)
  • (3)

Conjugate

  • (3)
  • (1)
  • (3)
  • (2)
  • (1)
  • (5)
  • (3)
  • (11)

Regulatory Status

  • (29)
Keyword Search:
1 – 15 of 59 results
3

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys27), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Content And Storage −20°C for one year
Host Species Rabbit
Applications ChIP Assay,Western Blot
Form Purified
Gene Accession No. Q16695
Includes Trimethyl-Histone H3 (Lys27) ChIP validated Antibody and Primer set including the ChIP-grade antibody and the specific control PCR primers used for chromatin immunoprecipitation of H3K27Me3.
Antigen Trimethyl-Histone H3 (Lys27)
Regulatory Status RUO
Gene Symbols H3F3A, MGC87783, H3.3A, MGC87782, H3F3, H3.3B, H3F3B
Gene ID (Entrez) NP_003484
Formulation Anti-trimethyl-Histone H3 (Lys27) (rabbit polyclonal IgG). One vial containing 100μg protein A purified IgG in 100μL buffer containing 0.1 M Tris-Glycine, pH 7.4, 0.15M NaCl with 0.05% sodium azide. Normal Rabbit IgG. One vial containing 125μg purified Rabbit IgG in 125μL storage buffer containing 0.1% sodium azide. ChIP Primers human alpha-Satellite. One vial containing 75μL of 5μM of each control primer specific for human alpha-Satellite. FOR: CTG CAC TAC CTG AAG AGG AC; REV: GAT GGT TCA ACA CTC TTA CA
Immunogen KLH-conjugated,synthetic 2X-branched peptide containing the sequence ...AR(me3K)SAP... in which me3K corresponds to trimethyl-lysine at residue 27 of human Histone H3.
Classification Polyclonal
Primary or Secondary Primary
Test Specificity trimethyl-Histone H3 (Lys27)
4

MilliporeSigma™ RIPAb+™ FXR1 RIP Validated Antibody and Primer Set

This RIPAb+ FXR1 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

5

Invitrogen™ eBioscience™ ProcartaPlex Human Th1/Th2 & Chemokine Panel 1 (20 plex)

Ideal solution for assessing multiple protein biomarkers in a single sample. Explore our broad portfolio of pre-configurated panels and combinable single analytes.

6

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys36)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Content And Storage -20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species Rabbit
Applications ChIP Assay,Dot Blot,Functional Assay,Western Blot
Form Purified
Gene Accession No. Q16695
Isotype IgG
Includes This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen Trimethyl-Histone H3 (Lys36)α
Regulatory Status RUO
Gene Symbols H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Purification Method Protein A purified
Gene ID (Entrez) NP_003484
Formulation Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT
Immunogen KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36).
Classification Monoclonal
Primary or Secondary Primary
Test Specificity Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa.
8

MilliporeSigma™ RIPAb+™ HuR RIP Validated Antibody and Primer Set

This RIPAb+ HuR -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

10

MilliporeSigma™ RIPAb+™ hnRNPA1 (M9 Region) RIP Validated Antibody and Primer Set

This RIPAb+ hnRNPA1 (M9 Region) -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

11

MilliporeSigma™ RIPAb+™ SMN RIP Validated Antibody and Primer Set

This RIPAb+ SMN -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

12

MilliporeSigma™ RIPAb+™ SMN RIP Validated Antibody and Primer Set

This RIPAb+ SMN -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

13

MilliporeSigma™ RIPAb+™ IGF2 mRNA-Binding Protein 3 RIP Validated Antibody and Primer Set

This RIPAb+ IGF2 mRNA-binding protein 3 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

14

MilliporeSigma™ RIPAb+™ PUM2 RIP Validated Antibody and Primer Set

Detect RIPAb+ PUM2 using this RIPAb+ PUM2 Antibody validated for use in ICC, IHC(P), Western Blotting, RNA Binding Protein Immunoprecipitation (RIP).

15

MilliporeSigma™ RIPAb+™ hnRNPA1 RIP Validated Antibody and Primer Set

This RIPAb+ hnRNPA1 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.