Antibody Panels and Kits

Combinations of antibody-related products that may include sets of antibodies in pairs and cocktails, control particles, buffers, and other kits and panels; for use in specific applications such as immunoassays and T-cell activation.

1 – 15 de 59 résultats

Invitrogen™ ELISA Assay Buffer (5X)

For use with antibody pairs (ELISA)

Prix et disponibilité

Invitrogen™ Click-iT™ Plus EdU Alexa Fluor™ 594 Flow Cytometry Assay Kit

Click-iT Plus EdU Alexa Fluor 594 Flow Cytometry Assay Kit

Prix et disponibilité

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys27), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Prix et disponibilité
Spécifications

Applications	ChIP Assay,Western Blot
Spécificité du test	trimethyl-Histone H3 (Lys27)
Primaire ou secondaire	Primary
Contenu et stockage	−20°C for one year
Forme	Purified
État réglementaire	RUO
Numéro d’ordre du gène	Q16695
Immunogène	KLH-conjugated,synthetic 2X-branched peptide containing the sequence ...AR(me3K)SAP... in which me3K corresponds to trimethyl-lysine at residue 27 of human Histone H3.
Classification	Polyclonal
Comprend	Trimethyl-Histone H3 (Lys27) ChIP validated Antibody and Primer set including the ChIP-grade antibody and the specific control PCR primers used for chromatin immunoprecipitation of H3K27Me3.
Identification génétique (Entrez)	NP_003484
Espèces hôtes	Rabbit
Symboles de gène(s)	H3F3A, MGC87783, H3.3A, MGC87782, H3F3, H3.3B, H3F3B
Formule	Anti-trimethyl-Histone H3 (Lys27) (rabbit polyclonal IgG). One vial containing 100μg protein A purified IgG in 100μL buffer containing 0.1 M Tris-Glycine, pH 7.4, 0.15M NaCl with 0.05% sodium azide. Normal Rabbit IgG. One vial containing 125μg purified Rabbit IgG in 125μL storage buffer containing 0.1% sodium azide. ChIP Primers human alpha-Satellite. One vial containing 75μL of 5μM of each control primer specific for human alpha-Satellite. FOR: CTG CAC TAC CTG AAG AGG AC; REV: GAT GGT TCA ACA CTC TTA CA
Antigène	Trimethyl-Histone H3 (Lys27)

MilliporeSigma™ RIPAb+™ FXR1 RIP Validated Antibody and Primer Set

This RIPAb+ FXR1 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

Prix et disponibilité

Invitrogen™ eBioscience™ ProcartaPlex Human Th1/Th2 & Chemokine Panel 1 (20 plex)

Ideal solution for assessing multiple protein biomarkers in a single sample. Explore our broad portfolio of pre-configurated panels and combinable single analytes.

Prix et disponibilité

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys36)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Prix et disponibilité
Spécifications

Applications	ChIP Assay,Dot Blot,Functional Assay,Western Blot
Spécificité du test	Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa.
Isotype	IgG
Primaire ou secondaire	Primary
Contenu et stockage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Forme	Purified
État réglementaire	RUO
Numéro d’ordre du gène	Q16695
Immunogène	KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36).
Classification	Monoclonal
Comprend	This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Identification génétique (Entrez)	NP_003484
Méthode de purification	Protein A purified
Espèces hôtes	Rabbit
Symboles de gène(s)	H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Formule	Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT
Antigène	Trimethyl-Histone H3 (Lys36)α

eBioscience™ Human/Non-Human Primate Regulatory T Cell Staining Kit #1

Antibody Staining Kit

Prix et disponibilité

MilliporeSigma™ RIPAb+™ HuR RIP Validated Antibody and Primer Set

This RIPAb+ HuR -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

Prix et disponibilité

Invitrogen™ TGF beta Human Matched Antibody Pair

Matched Antibody Pair

Prix et disponibilité

Anti-Mouse/Rat Foxp3 Staining Set APC, eBioscience™

Antibody Staining Kit

Prix et disponibilité

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys4)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Prix et disponibilité
Spécifications

Applications	ChIP Assay,ChIP sequencing (ChIP-seq),Western Blot
Spécificité du test	Trimethyl-Histone H3 (Lys4)
Isotype	IgG
Primaire ou secondaire	Primary
Contenu et stockage	−20°C for one year from date of shipment
Forme	Purified
État réglementaire	RUO
Numéro d’ordre du gène	Q66I33
Immunogène	The trimethyl-histone H3 (Lys4) antibody is made against a BSA-conjugated,synthetic peptide containing the sequence …RT[me3K]QT… in which me3K corresponds to trimethyl-lysine 4 of human histone H3
Classification	Monoclonal
Comprend	Trimethyl-Histone H3 (Lys4) ChIP validated Antibody and Primer set including the ChIP-grade antibody and the specific control PCR primers used for chromatin immunoprecipitation of H3K4Me3.
Identification génétique (Entrez)	NM_003493
Espèces hôtes	Rabbit
Symboles de gène(s)	H3F3A, H3F3B, H3F3
Formule	Anti-Trimethyl-Histone H3 (Lys4) recombin-ant rabbit monoclonal IgG. One vial containing 75μL of protein A purified rabbit IgG in storage buffer (0.1M Tris-Glycine pH 7.4, 0.15M NaCl, 0.05% NaN3, with the addition of 40% glycerol. Normal Rabbit IgG. One vial containing 75μL of normal rabbit IgG. Control Primers. One vial containing 75μL of 5μM of each primer specific for human GAPDH. FOR: TAC TAG CGG TTT TAC GGG CG REV: TCG AAC AGG AGG AGC AGA GAG CGA
Antigène	Trimethyl-Histone H3 (Lys4)α

MilliporeSigma™ Upstate™ Acetyl-Histone H4, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Prix et disponibilité
Spécifications

Applications	Multiplex,Functional Assay,Immunoassay,Western Blot
Spécificité du test	Recognizes acetylated histone H4 of approximately 10kDa. Cross-reacts with acetylated histone H2B from Tetrahymena and weakly crossreacts with acetylated histone H2B from HeLa cells. May cross-react with other acetylated proteins.
Primaire ou secondaire	Primary
Contenu et stockage	−20°C from date of receipt
Forme	Serum
État réglementaire	RUO
Numéro d’ordre du gène	P62805
Immunogène	The acetyl-histone H4 antiserum is made against a peptide corresponding to amino acids 2-19 of Tetrahymena histone H4.
Classification	Polyclonal
Comprend	This ChIPAb+ Acetyl-Histone H4 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Identification génétique (Entrez)	NP_778224
Espèces hôtes	Rabbit
Formule	Anti-Acetyl-Histone H4 (rabbit polyclonal IgG). One vial containing 100μL of antiserum containing 0.05% sodium azide. Normal Rabbit Serum. One vial containing 100μL antiserum containing 0.05% sodium azide. Control Primers. One vial containing 75μL of 5μM of each primer specific for for human GAPDH.
Antigène	Acetyl-Histone H4

MilliporeSigma™ Upstate™ EEDα, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Prix et disponibilité
Spécifications

Applications	ChIP Assay,Western Blot
Spécificité du test	Recognizes EED, MW: ∽50kDa.
Isotype	IgG2a κ
Primaire ou secondaire	Primary
Contenu et stockage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Forme	Purified
État réglementaire	RUO
Numéro d’ordre du gène	O75530
Immunogène	Recombinant fusion protein of full length murine EED tagged with MBP.
Classification	Monoclonal
Comprend	This ChIPAb+ EED -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Identification génétique (Entrez)	NP_003788
Espèces hôtes	Mouse
Symboles de gène(s)	EED; WAIT-1
Formule	Anti-EED (Mouse monoclonal IgG). One vial containing 50μg of protein G purified antibody in 0.1 M Tris-Glycine (pH 7.4) 150mM NaCl, containing 0.05% azide. May contain 30% glycerol (see certificate of analysis for details). Normal mouse IgG. Two vials containing 25μg of purified mouse IgG in 25μL of storage buffer containing 0.1% sodium azide. ChIP Primers, HoxA2 upstream. One vial containing 75μL of 5μM of each primer specific for the promoter region of human HoxA2. FOR: AGG AAA GAT TTT GGT TGG GAA G; REV: AAA AAG AGG GAA AGG GAC AGA C
Antigène	EEDα

MilliporeSigma™ Upstate™ E2F-1α, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Prix et disponibilité
Spécifications

Applications	ChIP Assay,ChIP sequencing (ChIP-seq),Immunoprecipitation
Spécificité du test	The epitopes have been mapped to amino acids 1 to 89 and to amino acids 342 to 386.
Isotype	IgG
Primaire ou secondaire	Primary
Contenu et stockage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Forme	Purified
État réglementaire	RUO
Numéro d’ordre du gène	Q01094
Immunogène	GST fusion protein corresponding to full-length human E2F-1.
Classification	Monoclonal
Comprend	This ChIPAb+ E2F-1 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Identification génétique (Entrez)	NP_005216
Méthode de purification	Protein G purified
Espèces hôtes	Mouse
Symboles de gène(s)	E2F1, RBAP-1, E2F-1, RBP3, RBBP3, RBBP-3, PBR3
Formule	Anti-E2F-1 (mouse monoclonal). One vial containing 25μg of protein G purified monoclonal mixed IgG in 25μL of buffer containing 0.1 M Tris-glycine, pH 7.4, 0.15 M NaCl with 0.05% sodium azide. Frozen solution. Nornal Mouse IgG. One vial containing 25μg of purified IgG in 25μL of storage buffer containing 0.1% sodium azide. ChIP Primers, CDC2 promoter. One vial containing 75μL of 5μM each primer specific for human CDC2 promoter. FOR: CGC CCT TTC CTC TTT CTT TC; REV: ATC GGG TAG CCC GTA GAC TT
Antigène	E2F-1α

MilliporeSigma™ Upstate™ Acetyl-Histone H4 (Lys8), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Prix et disponibilité
Spécifications

Applications	ChIP Assay,Immunoprecipitation,Western Blot
Spécificité du test	Recognizes acetyl-Histone H4 (Lys8).
Primaire ou secondaire	Primary
Contenu et stockage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Forme	Serum
État réglementaire	RUO
Numéro d’ordre du gène	P62805
Immunogène	Synthetic peptide corresponding to yeast Histone H4 acetylated at lysine 8.
Classification	Polyclonal
Comprend	The ChIPAb+ Acetyl-Histone H4 (Lys8) set includes the Acetyl-Histone H4 (Lys8) antibody, a negative control rabbit serum and qPCR primers which amplify a 134bp region of human HSPCA.
Identification génétique (Entrez)	NM_175054
Méthode de purification	Unpurified
Espèces hôtes	Rabbit
Symboles de gène(s)	HIST1H4A, H4/J, HIST1H4F, HIST1H4L, H4FN, H4FA, H4FH, HIST1H4H, H4F2, H4FM, H4/A, H4FK, H4FG, HIST2H4, H4FB, H4/K, HIST1H4I, H4/N, HIST1H4B, H4FE, H4/M, H4/a, HIST1H4E, HIST4H4, HIST2H4A, H4FC, H4FI, H4/H, HIST1H4C, H4/G, HIST1H4K, H4FJ, H4FD, H4/I, H4/B, H4/D, H4/C, HIST1H4J, HIST1H4D, H4/E
Formule	Anti-Acetyl-Histone H4 (Lys8) (rabbit polyclonal). One vial containing 50μL of antiserum containing 0.05% sodium azide. Normal Rabbit Serum. One vial containing 100μL of antiserum containing 0.05% sodium azide. ChIP Primers, HSPCA. One vial containing 75μL of 5μM of each primer specific for human HSPCA. FOR: GCA ACA GCT ACC ACA GGA CCA; REV: GAG CGT GTG AAA TCA ACA TAA AGC
Antigène	Acetyl-Histone H4 (Lys8)

Antibody Panels and Kits

Résultats de la recherche filtrée

Affiner les résultats