Panels et trousses d’anticorps
Combinaisons de produits liés aux anticorps qui peuvent comprendre des séries d’anticorps par paires et en mélanges, des particules de contrôle, des tampons et d’autres trousses et bilans; à utiliser dans des applications spécifiques comme les tests immunologiques et l’activation des lymphocytes T.
Quantité
- (1)
- (1)
- (8)
- (24)
- (1)
- (3)
- (1)
- (11)
- (1)
- (3)
- (1)
- (1)
- (1)
- (2)
Applications
- (10)
- (2)
- (8)
- (2)
- (10)
- (2)
- (1)
- (7)
- (3)
- (2)
- (28)
- (2)
- (36)
Classification
- (34)
- (18)
Espèces hôtes
- (1)
- (6)
- (1)
- (23)
- (13)
- (8)
Espèces cibles
- (1)
- (5)
- (3)
- (2)
- (6)
- (6)
- (1)
- (1)
- (1)
- (44)
- (7)
- (2)
- (7)
- (19)
- (6)
- (1)
- (1)
- (2)
- (10)
- (7)
- (1)
- (1)
- (4)
- (1)
- (2)
Résultats de la recherche filtrée
Les produits de certains de nos fournisseurs ne s'affichent pas dans les résultats de la recherche filtrée. Veuillez
supprimer tous les filtres
pour voir ces produits.
Rechercher dans les résultats
Recherche par mot-clé:
Effacer la recherche
1
–
15
de
59
résultats
| Applications | ChIP Assay,Immunoprecipitation,Western Blot |
|---|---|
| Numéro d’acquisition du gène | P62805 |
| Symboles de gène | HIST1H4A, H4/J, HIST1H4F, HIST1H4L, H4FN, H4FA, H4FH, HIST1H4H, H4F2, H4FM, H4/A, H4FK, H4FG, HIST2H4, H4FB, H4/K, HIST1H4I, H4/N, HIST1H4B, H4FE, H4/M, H4/a, HIST1H4E, HIST4H4, HIST2H4A, H4FC, H4FI, H4/H, HIST1H4C, H4/G, HIST1H4K, H4FJ, H4FD, H4/I, H4/B, H4/D, H4/C, HIST1H4J, HIST1H4D, H4/E |
| Statut réglementaire | RUO |
| Primaire ou secondaire | Primary |
| Contenu et stockage | -20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles |
| Forme | Serum |
| Immunogène | Synthetic peptide corresponding to yeast Histone H4 acetylated at lysine 8. |
| Spécifications de test | Recognizes acetyl-Histone H4 (Lys8). |
| Classification | Polyclonal |
| Comprend | The ChIPAb+ Acetyl-Histone H4 (Lys8) set includes the Acetyl-Histone H4 (Lys8) antibody, a negative control rabbit serum and qPCR primers which amplify a 134bp region of human HSPCA. |
| Méthode de purification | Unpurified |
| ID du gène (Entrez) | NM_175054 |
| Espèces hôtes | Rabbit |
| Formule | Anti-Acetyl-Histone H4 (Lys8) (rabbit polyclonal). One vial containing 50μL of antiserum containing 0.05% sodium azide. Normal Rabbit Serum. One vial containing 100μL of antiserum containing 0.05% sodium azide. ChIP Primers, HSPCA. One vial containing 75μL of 5μM of each primer specific for human HSPCA. FOR: GCA ACA GCT ACC ACA GGA CCA; REV: GAG CGT GTG AAA TCA ACA TAA AGC |
| Antigène | Acetyl-Histone H4 (Lys8) |
MilliporeSigma™ Upstate™ E2F-1α, Mouse monoclonal, ChIP Validated Antibody and Primer Set
Mouse Monoclonal Antibody
| Applications | ChIP Assay,ChIP sequencing (ChIP-seq),Immunoprecipitation |
|---|---|
| Numéro d’acquisition du gène | Q01094 |
| Symboles de gène | E2F1, RBAP-1, E2F-1, RBP3, RBBP3, RBBP-3, PBR3 |
| Isotype | IgG |
| Statut réglementaire | RUO |
| Primaire ou secondaire | Primary |
| Contenu et stockage | -20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles |
| Forme | Purified |
| Immunogène | GST fusion protein corresponding to full-length human E2F-1. |
| Spécifications de test | The epitopes have been mapped to amino acids 1 to 89 and to amino acids 342 to 386. |
| Classification | Monoclonal |
| Comprend | This ChIPAb+ E2F-1 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers. |
| Méthode de purification | Protein G purified |
| ID du gène (Entrez) | NP_005216 |
| Espèces hôtes | Mouse |
| Formule | Anti-E2F-1 (mouse monoclonal). One vial containing 25μg of protein G purified monoclonal mixed IgG in 25μL of buffer containing 0.1 M Tris-glycine, pH 7.4, 0.15 M NaCl with 0.05% sodium azide. Frozen solution. Nornal Mouse IgG. One vial containing 25μg of purified IgG in 25μL of storage buffer containing 0.1% sodium azide. ChIP Primers, CDC2 promoter. One vial containing 75μL of 5μM each primer specific for human CDC2 promoter. FOR: CGC CCT TTC CTC TTT CTT TC; REV: ATC GGG TAG CCC GTA GAC TT |
| Antigène | E2F-1α |
MilliporeSigma™ Upstate™ HDAC3 Mouse monoclonal, ChIP Validated Antibody and Primer Set
Mouse Monoclonal Antibody
| Applications | ChIP Assay,Western Blot |
|---|---|
| Numéro d’acquisition du gène | O15379 |
| Symboles de gène | HDAC3, SMAP45, HD3, RPD3, RPD3-2 |
| Isotype | IgG2a |
| Statut réglementaire | RUO |
| Primaire ou secondaire | Primary |
| Contenu et stockage | -20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles |
| Forme | Purified |
| Immunogène | peptide (NEFYDGDHDNDKESDVEI) corresponding to amino acids 411-428 of human HDAC3 |
| Classification | Monoclonal |
| Comprend | This ChIPAb+ HDAC3 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers. |
| ID du gène (Entrez) | NM_003883 |
| Espèces hôtes | Mouse |
| Formule | Anti-HDAC3 (mouse monoclonal). One vial containing 100μg of protein G purified monoclonal in buffer containing 0.02M phosphate buffer (pH 7.6), 0.25M NaCl, 0.1% sodium azide and 30% glycerol. Concentration: 1mg/mL. Normal Mouse IgG. One vial containing 125μg of purified mouse IgG in 125μL of storage buffer containing 0.1% sodium azide. ChIP Primers, p21. One vial containing 75μL of each primer (5μM) specific for a region of the human p21 (WAF1/CIP1/CDKN1A) promoter. FOR: CCC ACA GCA GAG GAG AAA GAA; REV: CTG GAA ATC TCT GCC CAG ACA |
| Antigène | HDAC3 |
MilliporeSigma™ RIPAb+™ SUZ12 RIP Validated Antibody and Primer Set
This RIPAb+ SUZ12 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Invitrogen™ eBioscience™ ProcartaPlex Human Th1/Th2 & Chemokine Panel 1 (20 plex)
Ideal solution for assessing multiple protein biomarkers in a single sample. Explore our broad portfolio of pre-configurated panels and combinable single analytes.
MilliporeSigma™ RIPAb+™ Ago2 RIP Validated Antibody and Primer Set
This RIPAb+ Ago2 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
MilliporeSigma™ RIPAb+™ PABPC1 RIP Validated Antibody and Primer Set
This RIPAb+ PABPC1 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
MilliporeSigma™ RIPAb+™ AUF1 RIP Validated Antibody and Primer Set
This RIPAb+ AUF1 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
| Applications | ChIP Assay,Dot Blot,Functional Assay,Western Blot |
|---|---|
| Numéro d’acquisition du gène | Q16695 |
| Symboles de gène | H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945 |
| Isotype | IgG |
| Statut réglementaire | RUO |
| Primaire ou secondaire | Primary |
| Contenu et stockage | -20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles |
| Forme | Purified |
| Immunogène | KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36). |
| Spécifications de test | Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa. |
| Classification | Monoclonal |
| Comprend | This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers. |
| Méthode de purification | Protein A purified |
| ID du gène (Entrez) | NP_003484 |
| Espèces hôtes | Rabbit |
| Formule | Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT |
| Antigène | Trimethyl-Histone H3 (Lys36)α |
| Applications | ChIP Assay,Immunoprecipitation,Western Blot |
|---|---|
| Numéro d’acquisition du gène | P62805 |
| Symboles de gène | HIST1H4A, H4/J, HIST1H4F, HIST1H4L, H4FN, H4FA, H4FH, HIST1H4H, H4F2, H4FM, H4/A, H4FK, H4FG, HIST2H4, H4FB, H4/K, HIST1H4I, H4/N, HIST1H4B, H4FE, H4/M, H4/a, HIST1H4E, HIST4H4, HIST2H4A, H4FC, H4FI, H4/H, HIST1H4C, H4/G, HIST1H4K, H4FJ, H4FD, H4/I, H4/B, H4/D, H4/C, HIST1H4J, HIST1H4D, H4/E |
| Isotype | IgG |
| Statut réglementaire | RUO |
| Primaire ou secondaire | Primary |
| Contenu et stockage | -20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles |
| Forme | Culture Supernatant |
| Immunogène | Peptide corresponding to Histone H4 containing the sequence [GRG-AcK-GGK] on which Lys5 is acetylated. |
| Spécifications de test | Recognizes Histone H4 acetylated on Lys5. |
| Classification | Monoclonal |
| Comprend | This ChIPAb+ Acetyl-Histone H4 (Lys5) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers. |
| ID du gène (Entrez) | NP_001029249 |
| Espèces hôtes | Rabbit |
| Formule | Anti-Acetyl-Histone H4 (Lys5) (rabbit monoclonal IgG). One vial containing 50μL of rabbit monoclonal IgG cell culture supernatant in 0.1% sodium azide. Negative Control Supernatant (rabbit). One vial containing 50μL of cultured supernatant in 0.05% sodium azide. Control Primers. One vial containing 75μL of 5μM each primer specific for the human GAPDH promoter. FOR: TAC TAG CGG TTT TAC GGG CG; REV: TCG AAC AGG AGG AGC AGA GAG CGA |
| Antigène | Acetyl-Histone H4 (Lys5)α |
