accessibility menu, dialog, popup

UserName

Antibody Panels and Kits

Combinations of antibody-related products that may include sets of antibodies in pairs and cocktails, control particles, buffers, and other kits and panels; for use in specific applications such as immunoassays and T-cell activation.
Quantité 
  • (1)
  • (1)
  • (8)
  • (24)
  • (1)
  • (3)
  • (1)
  • (11)
Applications 
  • (10)
  • (2)
  • (8)
  • (2)
  • (10)
  • (2)
  • (1)
  • (7)
Classification 
  • (34)
  • (18)
Espèces hôtes 
  • (1)
  • (6)
  • (1)
  • (23)
  • (13)
  • (8)
Espèces cibles 
  • (1)
  • (5)
  • (3)
  • (2)
  • (6)
  • (6)
  • (1)
  • (1)

Résultats de la recherche filtrée

Les produits de certains de nos fournisseurs ne s'affichent pas dans les résultats de la recherche filtrée. Veuillez supprimer tous les filtres pour voir ces produits.

Affiner les résultats

Affiner les résultats

catégorie

marques

  • (15)
  • (37)
  • (7)
  • (16)

Quantité

  • (1)
  • (1)
  • (8)
  • (24)
  • (1)
  • (3)
  • (1)
Afficher tous

Applications

  • (10)
  • (2)
  • (8)
  • (2)
  • (10)
  • (2)
  • (1)
Afficher tous

Classification

  • (34)
  • (18)

Espèces hôtes

  • (1)
  • (6)
  • (1)
  • (23)
  • (13)
  • (8)

Espèces cibles

  • (1)
  • (5)
  • (3)
  • (2)
  • (6)
  • (6)
  • (1)
Afficher tous

Forme

  • (2)
  • (1)
  • (1)
  • (7)
  • (28)
  • (2)

Isotype

  • (5)
  • (3)
  • (8)
  • (2)
  • (12)
  • (1)
  • (3)

Conjugué

  • (3)
  • (1)
  • (3)
  • (2)
  • (1)
  • (5)
  • (3)
Afficher tous

État réglementaire

  • (29)
Recherche par mot-clé:
1 – 15 de 59 résultats
2

Invitrogen™ ELISA TMB Stabilized Chromogen  DFS Item

For use with all sandwich ELISAs which utilize Horseradish Peroxidase (HRP) as detecting enzyme

3

MilliporeSigma™ RIPAb+™ hnRNPA1 (M9 Region) RIP Validated Antibody and Primer Set

This RIPAb+ hnRNPA1 (M9 Region) -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

4

MilliporeSigma™ RIPAb+™ hnRNPA1 RIP Validated Antibody and Primer Set

This RIPAb+ hnRNPA1 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

5

MilliporeSigma™ RIPAb+™ hnRNP U RIP Validated Antibody and Primer Set

This RIPAb+ hnRNP U -RIP Validated Antibody and Primer Set conveniently includes the hnRNP U antibody and the specific control PCR primers.

6

MilliporeSigma™ RIPAb+™ IGF2 mRNA-Binding Protein 3 RIP Validated Antibody and Primer Set

This RIPAb+ IGF2 mRNA-binding protein 3 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

7

MilliporeSigma™ RIPAb+™ SUZ12 RIP Validated Antibody and Primer Set

This RIPAb+ SUZ12 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

8

MilliporeSigma™ RIPAb+™ SMN RIP Validated Antibody and Primer Set

This RIPAb+ SMN -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

9

MilliporeSigma™ Upstate™ Acetyl-Histone H4 (Lys8), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Applications ChIP Assay,Immunoprecipitation,Western Blot
Spécificité du test Recognizes acetyl-Histone H4 (Lys8).
Primaire ou secondaire Primary
Contenu et stockage -20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Forme Serum
État réglementaire RUO
Numéro d’ordre du gène P62805
Immunogène Synthetic peptide corresponding to yeast Histone H4 acetylated at lysine 8.
Classification Polyclonal
Comprend The ChIPAb+ Acetyl-Histone H4 (Lys8) set includes the Acetyl-Histone H4 (Lys8) antibody, a negative control rabbit serum and qPCR primers which amplify a 134bp region of human HSPCA.
Identification génétique (Entrez) NM_175054
Méthode de purification Unpurified
Espèces hôtes Rabbit
Symboles de gène(s) HIST1H4A, H4/J, HIST1H4F, HIST1H4L, H4FN, H4FA, H4FH, HIST1H4H, H4F2, H4FM, H4/A, H4FK, H4FG, HIST2H4, H4FB, H4/K, HIST1H4I, H4/N, HIST1H4B, H4FE, H4/M, H4/a, HIST1H4E, HIST4H4, HIST2H4A, H4FC, H4FI, H4/H, HIST1H4C, H4/G, HIST1H4K, H4FJ, H4FD, H4/I, H4/B, H4/D, H4/C, HIST1H4J, HIST1H4D, H4/E
Formule Anti-Acetyl-Histone H4 (Lys8) (rabbit polyclonal). One vial containing 50μL of antiserum containing 0.05% sodium azide. Normal Rabbit Serum. One vial containing 100μL of antiserum containing 0.05% sodium azide. ChIP Primers, HSPCA. One vial containing 75μL of 5μM of each primer specific for human HSPCA. FOR: GCA ACA GCT ACC ACA GGA CCA; REV: GAG CGT GTG AAA TCA ACA TAA AGC
Antigène Acetyl-Histone H4 (Lys8)
10

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys36)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Applications ChIP Assay,Dot Blot,Functional Assay,Western Blot
Spécificité du test Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa.
Isotype IgG
Primaire ou secondaire Primary
Contenu et stockage -20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Forme Purified
État réglementaire RUO
Numéro d’ordre du gène Q16695
Immunogène KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36).
Classification Monoclonal
Comprend This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Identification génétique (Entrez) NP_003484
Méthode de purification Protein A purified
Espèces hôtes Rabbit
Symboles de gène(s) H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Formule Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT
Antigène Trimethyl-Histone H3 (Lys36)α
11

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys4)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Applications ChIP Assay,ChIP sequencing (ChIP-seq),Western Blot
Spécificité du test Trimethyl-Histone H3 (Lys4)
Isotype IgG
Primaire ou secondaire Primary
Contenu et stockage −20°C for one year from date of shipment
Forme Purified
État réglementaire RUO
Numéro d’ordre du gène Q66I33
Immunogène The trimethyl-histone H3 (Lys4) antibody is made against a BSA-conjugated,synthetic peptide containing the sequence …RT[me3K]QT… in which me3K corresponds to trimethyl-lysine 4 of human histone H3
Classification Monoclonal
Comprend Trimethyl-Histone H3 (Lys4) ChIP validated Antibody and Primer set including the ChIP-grade antibody and the specific control PCR primers used for chromatin immunoprecipitation of H3K4Me3.
Identification génétique (Entrez) NM_003493
Espèces hôtes Rabbit
Symboles de gène(s) H3F3A, H3F3B, H3F3
Formule Anti-Trimethyl-Histone H3 (Lys4) recombin-ant rabbit monoclonal IgG. One vial containing 75μL of protein A purified rabbit IgG in storage buffer (0.1M Tris-Glycine pH 7.4, 0.15M NaCl, 0.05% NaN3, with the addition of 40% glycerol.
Normal Rabbit IgG. One vial containing 75μL of normal rabbit IgG.
Control Primers. One vial containing 75μL of 5μM of each primer specific for human GAPDH. FOR: TAC TAG CGG TTT TAC GGG CG REV: TCG AAC AGG AGG AGC AGA GAG CGA
Antigène Trimethyl-Histone H3 (Lys4)α
12

MilliporeSigma™ RIPAb+™ Upf1 RIP Validated Antibody and Primer Set

This RIPAb+ Upf1 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

13

MilliporeSigma™ RIPAb+™ EED RIP Validated Antibody and Primer Set

This RIPAb+ EED -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

14

MilliporeSigma™ RIPAb+™ Ago2 RIP Validated Antibody and Primer Set

This RIPAb+ Ago2 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

15

MilliporeSigma™ Upstate™ Acetyl-Histone H4, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Applications Multiplex,Functional Assay,Immunoassay,Western Blot
Spécificité du test Recognizes acetylated histone H4 of approximately 10kDa. Cross-reacts with acetylated histone H2B from Tetrahymena and weakly crossreacts with acetylated histone H2B from HeLa cells. May cross-react with other acetylated proteins.
Primaire ou secondaire Primary
Contenu et stockage −20°C from date of receipt
Forme Serum
État réglementaire RUO
Numéro d’ordre du gène P62805
Immunogène The acetyl-histone H4 antiserum is made against a peptide corresponding to amino acids 2-19 of Tetrahymena histone H4.
Classification Polyclonal
Comprend This ChIPAb+ Acetyl-Histone H4 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Identification génétique (Entrez) NP_778224
Espèces hôtes Rabbit
Formule Anti-Acetyl-Histone H4 (rabbit polyclonal IgG). One vial containing 100μL of antiserum containing 0.05% sodium azide. Normal Rabbit Serum. One vial containing 100μL antiserum containing 0.05% sodium azide. Control Primers. One vial containing 75μL of 5μM of each primer specific for for human GAPDH.
Antigène Acetyl-Histone H4