accessibility menu, dialog, popup

UserName

Antibody Panels and Kits

Combinations of antibody-related products that may include sets of antibodies in pairs and cocktails, control particles, buffers, and other kits and panels; for use in specific applications such as immunoassays and T-cell activation.
Quantity 
  • (1)
  • (1)
  • (8)
  • (24)
  • (1)
  • (3)
  • (1)
  • (11)
  • (1)
  • (3)
  • (1)
  • (1)
  • (1)
  • (2)
Applications 
  • (10)
  • (2)
  • (8)
  • (2)
  • (10)
  • (2)
  • (1)
  • (7)
  • (3)
  • (2)
  • (28)
  • (2)
  • (36)
Classification 
  • (34)
  • (18)
Host Species 
  • (1)
  • (6)
  • (1)
  • (23)
  • (13)
  • (8)
Target Species 
  • (1)
  • (5)
  • (3)
  • (2)
  • (6)
  • (6)
  • (1)
  • (1)
  • (1)
  • (44)
  • (7)
  • (2)
  • (7)
  • (19)
  • (6)
  • (1)
  • (1)
  • (2)
  • (10)
  • (7)
  • (1)
  • (1)
  • (4)
  • (1)
  • (2)

Filtered Search Results

Products from some of our suppliers do not display in filtered search results. Please clear all filters to see these products.

Narrow Results

Narrow Results

category

brands

  • (15)
  • (37)
  • (7)
  • (1)

Quantity

  • (1)
  • (1)
  • (8)
  • (24)
  • (1)
  • (3)
  • (1)
  • (11)
  • (1)
  • (3)
  • (1)
  • (1)
  • (1)
  • (2)

Applications

  • (10)
  • (2)
  • (8)
  • (2)
  • (10)
  • (2)
  • (1)
  • (7)
  • (3)
  • (2)
  • (28)
  • (2)
  • (36)

Classification

  • (34)
  • (18)

Host Species

  • (1)
  • (6)
  • (1)
  • (23)
  • (13)
  • (8)

Target Species

  • (1)
  • (5)
  • (3)
  • (2)
  • (6)
  • (6)
  • (1)
  • (1)
  • (1)
  • (44)
  • (7)
  • (2)
  • (7)
  • (19)
  • (6)
  • (1)
  • (1)
  • (2)
  • (10)
  • (7)
  • (1)
  • (1)
  • (4)
  • (1)
  • (2)

Form

  • (2)
  • (1)
  • (1)
  • (7)
  • (28)
  • (2)

Isotype

  • (5)
  • (3)
  • (8)
  • (2)
  • (12)
  • (1)
  • (3)

Conjugate

  • (3)
  • (1)
  • (3)
  • (2)
  • (1)
  • (5)
  • (3)
  • (11)

Regulatory Status

  • (29)

Search Within Results
Keyword Search:
1 – 15 of 59 results
1

MilliporeSigma™ RIPAb+™ PABPC1 RIP Validated Antibody and Primer Set

This RIPAb+ PABPC1 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

2

MilliporeSigma™ RIPAb+™ AUF1 RIP Validated Antibody and Primer Set

This RIPAb+ AUF1 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

5

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys36)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Content And Storage -20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species Rabbit
Applications ChIP Assay,Dot Blot,Functional Assay,Western Blot
Form Purified
Gene Accession No. Q16695
Isotype IgG
Includes This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen Trimethyl-Histone H3 (Lys36)α
Regulatory Status RUO
Gene Symbols H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Purification Method Protein A purified
Gene ID (Entrez) NP_003484
Formulation Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT
Immunogen KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36).
Classification Monoclonal
Primary or Secondary Primary
Test Specificity Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa.
6

MilliporeSigma™ Upstate™ Acetyl-Histone H4 (Lys5)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Content And Storage -20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species Rabbit
Applications ChIP Assay,Immunoprecipitation,Western Blot
Form Culture Supernatant
Gene Accession No. P62805
Isotype IgG
Includes This ChIPAb+ Acetyl-Histone H4 (Lys5) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen Acetyl-Histone H4 (Lys5)α
Regulatory Status RUO
Gene Symbols HIST1H4A, H4/J, HIST1H4F, HIST1H4L, H4FN, H4FA, H4FH, HIST1H4H, H4F2, H4FM, H4/A, H4FK, H4FG, HIST2H4, H4FB, H4/K, HIST1H4I, H4/N, HIST1H4B, H4FE, H4/M, H4/a, HIST1H4E, HIST4H4, HIST2H4A, H4FC, H4FI, H4/H, HIST1H4C, H4/G, HIST1H4K, H4FJ, H4FD, H4/I, H4/B, H4/D, H4/C, HIST1H4J, HIST1H4D, H4/E
Gene ID (Entrez) NP_001029249
Formulation Anti-Acetyl-Histone H4 (Lys5) (rabbit monoclonal IgG). One vial containing 50μL of rabbit monoclonal IgG cell culture supernatant in 0.1% sodium azide. Negative Control Supernatant (rabbit). One vial containing 50μL of cultured supernatant in 0.05% sodium azide. Control Primers. One vial containing 75μL of 5μM each primer specific for the human GAPDH promoter. FOR: TAC TAG CGG TTT TAC GGG CG; REV: TCG AAC AGG AGG AGC AGA GAG CGA
Immunogen Peptide corresponding to Histone H4 containing the sequence [GRG-AcK-GGK] on which Lys5 is acetylated.
Classification Monoclonal
Primary or Secondary Primary
Test Specificity Recognizes Histone H4 acetylated on Lys5.
7

MilliporeSigma™ RIPAb+™ SUZ12 RIP Validated Antibody and Primer Set

This RIPAb+ SUZ12 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

8

Invitrogen™ eBioscience™ ProcartaPlex Human Th1/Th2 & Chemokine Panel 1 (20 plex)

Ideal solution for assessing multiple protein biomarkers in a single sample. Explore our broad portfolio of pre-configurated panels and combinable single analytes.

9

MilliporeSigma™ RIPAb+™ IGF2BP2 RIP Validated Antibody and Primer Set

This RIPAb+ IGF2BP2 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

10

MilliporeSigma™ RIPAb+™ SMN RIP Validated Antibody and Primer Set

This RIPAb+ SMN -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

11

MilliporeSigma™ Upstate™ Androgen Receptor- ChIP Validated, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Content And Storage -20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species Rabbit
Applications ChIP Assay,Immunohistochemistry,Immunoprecipitation,Western Blot
Gene Accession No. P10275
Includes ChIPAb+ Androgen Receptor set includes the Androgen Receptor antibody, a Normal Rabbit IgG, and control primers, which amplify a 85bp region of the human prostate specific antigen (PSA) enhancer region.
Antigen Androgen Receptor- ChIP Validated
Regulatory Status RUO
Gene Symbols AR, DHTR, SMAX1, HUMARA, KD, SBMA, TFM, OTTHUMP00000061928, AIS, NR3C4
Purification Method Affinity Purified
Gene ID (Entrez) NP_000035
Formulation Anti-Androgen Receptor (Rabbit Polyclonal). One vial containing 125μL (0.2μg/μL) purified rabbit polyclonal in buffer containing 0.1M Tris-Glycine (pH 7.4), 150mM NaCl, and 0.05% sodium azide, before the addition of 30% glycerol. Normal Rabbit IgG. One vial containing 125μg (1.0μg/μL) Rabbit IgG in 125μL storage buffer containing 0.05% sodium azide. ChIP Primers, PSA. One vial containing 75μL of 5μM of each primer specific for human prostate-specific antigen enhancer region. (chr19:51354179+51354263, hg19 build) FOR: 5’ GCC TGG ATC TGA GAG AGA TAT CAT C 3’; REV: 5’ ACA CCT TTT TTT TTC TGG ATT GTT G 3’
Immunogen Peptide corresponding to amino acids 1-21 of the Human Androgen Receptor (MEVQLGLGRVYPRPPSKTYRG)
Classification Polyclonal
Primary or Secondary Primary
Test Specificity Recognizes Androgen Receptor. No cross-reactivity with estrogen, progesterone or glucocorticoid receptors.
12

MilliporeSigma™ RIPAb+™ EF1α RIP Validated Antibody and Primer Set

This RIPAb+ EF1α -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

13

MilliporeSigma™ RIPAb+™ Fragile X Mental Retardation RIP Validated Antibody and Primer Set

This RIPAb+ Fragile X Mental Retardation Protein -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

14

MilliporeSigma™ Upstate™ Acetyl-Histone H4, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Content And Storage −20°C from date of receipt
Host Species Rabbit
Applications Multiplex,Functional Assay,Immunoassay,Western Blot
Form Serum
Gene Accession No. P62805
Includes This ChIPAb+ Acetyl-Histone H4 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen Acetyl-Histone H4
Regulatory Status RUO
Gene ID (Entrez) NP_778224
Formulation Anti-Acetyl-Histone H4 (rabbit polyclonal IgG). One vial containing 100μL of antiserum containing 0.05% sodium azide. Normal Rabbit Serum. One vial containing 100μL antiserum containing 0.05% sodium azide. Control Primers. One vial containing 75μL of 5μM of each primer specific for for human GAPDH.
Immunogen The acetyl-histone H4 antiserum is made against a peptide corresponding to amino acids 2-19 of Tetrahymena histone H4.
Classification Polyclonal
Primary or Secondary Primary
Test Specificity Recognizes acetylated histone H4 of approximately 10kDa. Cross-reacts with acetylated histone H2B from Tetrahymena and weakly crossreacts with acetylated histone H2B from HeLa cells. May cross-react with other acetylated proteins.