Panels et trousses d’anticorps
- (1)
- (1)
- (8)
- (24)
- (1)
- (3)
- (1)
- (11)
- (1)
- (3)
- (1)
- (1)
- (1)
- (2)
- (10)
- (2)
- (8)
- (2)
- (10)
- (2)
- (1)
- (7)
- (3)
- (2)
- (28)
- (2)
- (36)
- (34)
- (18)
- (1)
- (6)
- (1)
- (23)
- (13)
- (8)
- (1)
- (5)
- (3)
- (2)
- (6)
- (6)
- (1)
- (1)
- (1)
- (44)
- (7)
- (2)
- (7)
- (19)
- (6)
- (1)
- (1)
- (2)
- (10)
- (7)
- (1)
- (1)
- (4)
- (1)
- (2)
Résultats de la recherche filtrée
| Applications | ChIP Assay,Dot Blot,Functional Assay,Western Blot |
|---|---|
| Numéro d’acquisition du gène | Q16695 |
| Symboles de gène | H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945 |
| Isotype | IgG |
| Statut réglementaire | RUO |
| Primaire ou secondaire | Primary |
| Contenu et stockage | -20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles |
| Forme | Purified |
| Immunogène | KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36). |
| Spécifications de test | Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa. |
| Classification | Monoclonal |
| Comprend | This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers. |
| Méthode de purification | Protein A purified |
| ID du gène (Entrez) | NP_003484 |
| Espèces hôtes | Rabbit |
| Formule | Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT |
| Antigène | Trimethyl-Histone H3 (Lys36)α |
| Applications | ChIP Assay,Immunoprecipitation,Western Blot |
|---|---|
| Numéro d’acquisition du gène | P62805 |
| Symboles de gène | HIST1H4A, H4/J, HIST1H4F, HIST1H4L, H4FN, H4FA, H4FH, HIST1H4H, H4F2, H4FM, H4/A, H4FK, H4FG, HIST2H4, H4FB, H4/K, HIST1H4I, H4/N, HIST1H4B, H4FE, H4/M, H4/a, HIST1H4E, HIST4H4, HIST2H4A, H4FC, H4FI, H4/H, HIST1H4C, H4/G, HIST1H4K, H4FJ, H4FD, H4/I, H4/B, H4/D, H4/C, HIST1H4J, HIST1H4D, H4/E |
| Isotype | IgG |
| Statut réglementaire | RUO |
| Primaire ou secondaire | Primary |
| Contenu et stockage | -20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles |
| Forme | Culture Supernatant |
| Immunogène | Peptide corresponding to Histone H4 containing the sequence [GRG-AcK-GGK] on which Lys5 is acetylated. |
| Spécifications de test | Recognizes Histone H4 acetylated on Lys5. |
| Classification | Monoclonal |
| Comprend | This ChIPAb+ Acetyl-Histone H4 (Lys5) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers. |
| ID du gène (Entrez) | NP_001029249 |
| Espèces hôtes | Rabbit |
| Formule | Anti-Acetyl-Histone H4 (Lys5) (rabbit monoclonal IgG). One vial containing 50μL of rabbit monoclonal IgG cell culture supernatant in 0.1% sodium azide. Negative Control Supernatant (rabbit). One vial containing 50μL of cultured supernatant in 0.05% sodium azide. Control Primers. One vial containing 75μL of 5μM each primer specific for the human GAPDH promoter. FOR: TAC TAG CGG TTT TAC GGG CG; REV: TCG AAC AGG AGG AGC AGA GAG CGA |
| Antigène | Acetyl-Histone H4 (Lys5)α |
MilliporeSigma™ RIPAb+™ SUZ12 RIP Validated Antibody and Primer Set
This RIPAb+ SUZ12 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Invitrogen™ eBioscience™ ProcartaPlex Human Th1/Th2 & Chemokine Panel 1 (20 plex)
Ideal solution for assessing multiple protein biomarkers in a single sample. Explore our broad portfolio of pre-configurated panels and combinable single analytes.
MilliporeSigma™ RIPAb+™ IGF2BP2 RIP Validated Antibody and Primer Set
This RIPAb+ IGF2BP2 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
MilliporeSigma™ RIPAb+™ SMN RIP Validated Antibody and Primer Set
This RIPAb+ SMN -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
| Applications | ChIP Assay,Immunohistochemistry,Immunoprecipitation,Western Blot |
|---|---|
| Numéro d’acquisition du gène | P10275 |
| Symboles de gène | AR, DHTR, SMAX1, HUMARA, KD, SBMA, TFM, OTTHUMP00000061928, AIS, NR3C4 |
| Statut réglementaire | RUO |
| Primaire ou secondaire | Primary |
| Contenu et stockage | -20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles |
| Immunogène | Peptide corresponding to amino acids 1-21 of the Human Androgen Receptor (MEVQLGLGRVYPRPPSKTYRG) |
| Spécifications de test | Recognizes Androgen Receptor. No cross-reactivity with estrogen, progesterone or glucocorticoid receptors. |
| Classification | Polyclonal |
| Comprend | ChIPAb+ Androgen Receptor set includes the Androgen Receptor antibody, a Normal Rabbit IgG, and control primers, which amplify a 85bp region of the human prostate specific antigen (PSA) enhancer region. |
| Méthode de purification | Affinity Purified |
| ID du gène (Entrez) | NP_000035 |
| Espèces hôtes | Rabbit |
| Formule | Anti-Androgen Receptor (Rabbit Polyclonal). One vial containing 125μL (0.2μg/μL) purified rabbit polyclonal in buffer containing 0.1M Tris-Glycine (pH 7.4), 150mM NaCl, and 0.05% sodium azide, before the addition of 30% glycerol. Normal Rabbit IgG. One vial containing 125μg (1.0μg/μL) Rabbit IgG in 125μL storage buffer containing 0.05% sodium azide. ChIP Primers, PSA. One vial containing 75μL of 5μM of each primer specific for human prostate-specific antigen enhancer region. (chr19:51354179+51354263, hg19 build) FOR: 5’ GCC TGG ATC TGA GAG AGA TAT CAT C 3’; REV: 5’ ACA CCT TTT TTT TTC TGG ATT GTT G 3’ |
| Antigène | Androgen Receptor- ChIP Validated |
Invitrogen™ Click-iT™ Plus EdU Alexa Fluor™ 594 Flow Cytometry Assay Kit
Click-iT Plus EdU Alexa Fluor 594 Flow Cytometry Assay Kit
MilliporeSigma™ RIPAb+™ HuR RIP Validated Antibody and Primer Set
This RIPAb+ HuR -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
MilliporeSigma™ RIPAb+™ STAU1 (Staufen 1) RIP Validated Antibody and Primer Set
This RIPAb+ STAU1 (Staufen 1) -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.