accessibility menu, dialog, popup

UserName

Antibody Panels and Kits

Combinations of antibody-related products that may include sets of antibodies in pairs and cocktails, control particles, buffers, and other kits and panels; for use in specific applications such as immunoassays and T-cell activation.
Quantité 
  • (1)
  • (1)
  • (8)
  • (24)
  • (1)
  • (3)
  • (1)
  • (11)
  • (1)
  • (3)
  • (1)
  • (1)
  • (1)
  • (2)
Applications 
  • (10)
  • (2)
  • (8)
  • (2)
  • (10)
  • (2)
  • (1)
  • (7)
  • (3)
  • (2)
  • (28)
  • (2)
  • (36)
Classification 
  • (34)
  • (18)
Espèces hôtes 
  • (1)
  • (6)
  • (1)
  • (23)
  • (13)
  • (8)
Espèces cibles 
  • (1)
  • (5)
  • (3)
  • (2)
  • (6)
  • (6)
  • (1)
  • (1)
  • (1)
  • (44)
  • (7)
  • (2)
  • (7)
  • (19)
  • (6)
  • (1)
  • (1)
  • (2)
  • (10)
  • (7)
  • (1)
  • (1)
  • (4)
  • (1)
  • (2)

Résultats de la recherche filtrée

Les produits de certains de nos fournisseurs ne s'affichent pas dans les résultats de la recherche filtrée. Veuillez supprimer tous les filtres pour voir ces produits.

Affiner les résultats

Affiner les résultats

catégorie

marques

  • (15)
  • (37)
  • (7)
  • (1)

Quantité

  • (1)
  • (1)
  • (8)
  • (24)
  • (1)
  • (3)
  • (1)
  • (11)
  • (1)
  • (3)
  • (1)
  • (1)
  • (1)
  • (2)

Applications

  • (10)
  • (2)
  • (8)
  • (2)
  • (10)
  • (2)
  • (1)
  • (7)
  • (3)
  • (2)
  • (28)
  • (2)
  • (36)

Classification

  • (34)
  • (18)

Espèces hôtes

  • (1)
  • (6)
  • (1)
  • (23)
  • (13)
  • (8)

Espèces cibles

  • (1)
  • (5)
  • (3)
  • (2)
  • (6)
  • (6)
  • (1)
  • (1)
  • (1)
  • (44)
  • (7)
  • (2)
  • (7)
  • (19)
  • (6)
  • (1)
  • (1)
  • (2)
  • (10)
  • (7)
  • (1)
  • (1)
  • (4)
  • (1)
  • (2)

Forme

  • (2)
  • (1)
  • (1)
  • (7)
  • (28)
  • (2)

Isotype

  • (5)
  • (3)
  • (8)
  • (2)
  • (12)
  • (1)
  • (3)

Conjugué

  • (3)
  • (1)
  • (3)
  • (2)
  • (1)
  • (5)
  • (3)
  • (11)

État réglementaire

  • (29)
Rechercher dans les résultats
Recherche par mot-clé:
1 – 15 de 59 résultats
1

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys36)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Applications ChIP Assay,Dot Blot,Functional Assay,Western Blot
Spécificité du test Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa.
Isotype IgG
Primaire ou secondaire Primary
Contenu et stockage -20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Forme Purified
État réglementaire RUO
Numéro d’ordre du gène Q16695
Immunogène KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36).
Classification Monoclonal
Comprend This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Identification génétique (Entrez) NP_003484
Méthode de purification Protein A purified
Espèces hôtes Rabbit
Symboles de gène(s) H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Formule Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT
Antigène Trimethyl-Histone H3 (Lys36)α
3

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys4)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Applications ChIP Assay,ChIP sequencing (ChIP-seq),Western Blot
Spécificité du test Trimethyl-Histone H3 (Lys4)
Isotype IgG
Primaire ou secondaire Primary
Contenu et stockage −20°C for one year from date of shipment
Forme Purified
État réglementaire RUO
Numéro d’ordre du gène Q66I33
Immunogène The trimethyl-histone H3 (Lys4) antibody is made against a BSA-conjugated,synthetic peptide containing the sequence …RT[me3K]QT… in which me3K corresponds to trimethyl-lysine 4 of human histone H3
Classification Monoclonal
Comprend Trimethyl-Histone H3 (Lys4) ChIP validated Antibody and Primer set including the ChIP-grade antibody and the specific control PCR primers used for chromatin immunoprecipitation of H3K4Me3.
Identification génétique (Entrez) NM_003493
Espèces hôtes Rabbit
Symboles de gène(s) H3F3A, H3F3B, H3F3
Formule Anti-Trimethyl-Histone H3 (Lys4) recombin-ant rabbit monoclonal IgG. One vial containing 75μL of protein A purified rabbit IgG in storage buffer (0.1M Tris-Glycine pH 7.4, 0.15M NaCl, 0.05% NaN3, with the addition of 40% glycerol.
Normal Rabbit IgG. One vial containing 75μL of normal rabbit IgG.
Control Primers. One vial containing 75μL of 5μM of each primer specific for human GAPDH. FOR: TAC TAG CGG TTT TAC GGG CG REV: TCG AAC AGG AGG AGC AGA GAG CGA
Antigène Trimethyl-Histone H3 (Lys4)α
4

MilliporeSigma™ Upstate™ Monomethyl-Histone H4 (Lys20), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Applications ChIP Assay,Western Blot
Spécificité du test Recognizes histone H4, Mr ∽11kDa.
Primaire ou secondaire Primary
Contenu et stockage -20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
État réglementaire RUO
Numéro d’ordre du gène P62805
Immunogène The immunogen was a synthetic peptide corresponding to amino acids 15-24 of histone H4,monomethylated on Lys20.
Classification Polyclonal
Comprend This ChIPAb+ Monomethyl-Histone H4 (Lys20) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Identification génétique (Entrez) NM_003538.3
Méthode de purification Affinity Purified
Espèces hôtes Rabbit
Symboles de gène(s) H4/A , H4/B, H4/C , H4/D, H4/E, H4/G, H4/H, H4/I, H4/J, H4/J, H4/M, H4/N, H4/O , H4/a , H4F2, H4FA , H4FB , H4FC , H4FD, H4FE, H4FG, H4FH, H4FI , H4FJ, H4FK, H4FM , H4FN, H4FO, HIST2H4
Formule Anti-monomethyl-Histone H4 (Lys20) (rabbit polyclonal IgG). One vial containing 100μg of affinity purified antibody in 100μL 0.1M Tris-Glycine (pH 7.4), 15mM NaCl, and 0.05% NaN3. Normal Rabbit IgG. One vial containing 125μg of purified rabbit IgG in 125μL storage buffer. ChIP Primers GAPDH Coding Region. One vial containing 75μL of 5μM of each primer specific for human GAPDH coding region. FOR: GGC TCC CAC CTT TCT CAT CC; REV: GGC CAT CCA CAG TCT TCT GG
Antigène Monomethyl-Histone H4 (Lys20)
5

MilliporeSigma™ RIPAb+™ CUGBP2 RIP Validated Antibody and Primer Set

This RIPAb+ CUGBP2 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

7

MilliporeSigma™ RIPAb+™ hnRNP U RIP Validated Antibody and Primer Set

This RIPAb+ hnRNP U -RIP Validated Antibody and Primer Set conveniently includes the hnRNP U antibody and the specific control PCR primers.

8

MilliporeSigma™ RIPAb+™ pan Ago RIP Validated Antibody and Primer Set

This RIPAb+ pan Ago -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

12

MilliporeSigma™ Upstate™ Acetyl-Histone H4 (Lys8), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Applications ChIP Assay,Immunoprecipitation,Western Blot
Spécificité du test Recognizes acetyl-Histone H4 (Lys8).
Primaire ou secondaire Primary
Contenu et stockage -20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Forme Serum
État réglementaire RUO
Numéro d’ordre du gène P62805
Immunogène Synthetic peptide corresponding to yeast Histone H4 acetylated at lysine 8.
Classification Polyclonal
Comprend The ChIPAb+ Acetyl-Histone H4 (Lys8) set includes the Acetyl-Histone H4 (Lys8) antibody, a negative control rabbit serum and qPCR primers which amplify a 134bp region of human HSPCA.
Identification génétique (Entrez) NM_175054
Méthode de purification Unpurified
Espèces hôtes Rabbit
Symboles de gène(s) HIST1H4A, H4/J, HIST1H4F, HIST1H4L, H4FN, H4FA, H4FH, HIST1H4H, H4F2, H4FM, H4/A, H4FK, H4FG, HIST2H4, H4FB, H4/K, HIST1H4I, H4/N, HIST1H4B, H4FE, H4/M, H4/a, HIST1H4E, HIST4H4, HIST2H4A, H4FC, H4FI, H4/H, HIST1H4C, H4/G, HIST1H4K, H4FJ, H4FD, H4/I, H4/B, H4/D, H4/C, HIST1H4J, HIST1H4D, H4/E
Formule Anti-Acetyl-Histone H4 (Lys8) (rabbit polyclonal). One vial containing 50μL of antiserum containing 0.05% sodium azide. Normal Rabbit Serum. One vial containing 100μL of antiserum containing 0.05% sodium azide. ChIP Primers, HSPCA. One vial containing 75μL of 5μM of each primer specific for human HSPCA. FOR: GCA ACA GCT ACC ACA GGA CCA; REV: GAG CGT GTG AAA TCA ACA TAA AGC
Antigène Acetyl-Histone H4 (Lys8)
13

MilliporeSigma™ Upstate™ HDAC3 Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Applications ChIP Assay,Western Blot
Isotype IgG2a
Primaire ou secondaire Primary
Contenu et stockage -20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Forme Purified
État réglementaire RUO
Numéro d’ordre du gène O15379
Immunogène peptide (NEFYDGDHDNDKESDVEI) corresponding to amino acids 411-428 of human HDAC3
Classification Monoclonal
Comprend This ChIPAb+ HDAC3 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Identification génétique (Entrez) NM_003883
Espèces hôtes Mouse
Symboles de gène(s) HDAC3, SMAP45, HD3, RPD3, RPD3-2
Formule Anti-HDAC3 (mouse monoclonal). One vial containing 100μg of protein G purified monoclonal in buffer containing 0.02M phosphate buffer (pH 7.6), 0.25M NaCl, 0.1% sodium azide and 30% glycerol. Concentration: 1mg/mL. Normal Mouse IgG. One vial containing 125μg of purified mouse IgG in 125μL of storage buffer containing 0.1% sodium azide. ChIP Primers, p21. One vial containing 75μL of each primer (5μM) specific for a region of the human p21 (WAF1/CIP1/CDKN1A) promoter. FOR: CCC ACA GCA GAG GAG AAA GAA; REV: CTG GAA ATC TCT GCC CAG ACA
Antigène HDAC3
14

MilliporeSigma™ RIPAb+™ Ago1 RIP Validated Antibody and Primer Set

This RIPAb+ Ago1 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.