Antibody Panels and Kits
Combinations of antibody-related products that may include sets of antibodies in pairs and cocktails, control particles, buffers, and other kits and panels; for use in specific applications such as immunoassays and T-cell activation.
Quantité
- (1)
- (1)
- (8)
- (24)
- (1)
- (3)
- (1)
- (11)
Applications
- (10)
- (2)
- (8)
- (2)
- (10)
- (2)
- (1)
- (7)
Classification
- (34)
- (18)
Espèces hôtes
- (1)
- (6)
- (1)
- (23)
- (13)
- (8)
Espèces cibles
- (1)
- (5)
- (3)
- (2)
- (6)
- (6)
- (1)
- (1)
Résultats de la recherche filtrée
Les produits de certains de nos fournisseurs ne s'affichent pas dans les résultats de la recherche filtrée. Veuillez
supprimer tous les filtres
pour voir ces produits.
Recherche par mot-clé:
Effacer la recherche
1
–
15
de
59
résultats
Invitrogen™ Click-iT™ Plus EdU Alexa Fluor™ 594 Flow Cytometry Assay Kit
Click-iT Plus EdU Alexa Fluor 594 Flow Cytometry Assay Kit
| Applications | ChIP Assay,Western Blot |
|---|---|
| Spécificité du test | trimethyl-Histone H3 (Lys27) |
| Primaire ou secondaire | Primary |
| Contenu et stockage | −20°C for one year |
| Forme | Purified |
| État réglementaire | RUO |
| Numéro d’ordre du gène | Q16695 |
| Immunogène | KLH-conjugated,synthetic 2X-branched peptide containing the sequence ...AR(me3K)SAP... in which me3K corresponds to trimethyl-lysine at residue 27 of human Histone H3. |
| Classification | Polyclonal |
| Comprend | Trimethyl-Histone H3 (Lys27) ChIP validated Antibody and Primer set including the ChIP-grade antibody and the specific control PCR primers used for chromatin immunoprecipitation of H3K27Me3. |
| Identification génétique (Entrez) | NP_003484 |
| Espèces hôtes | Rabbit |
| Symboles de gène(s) | H3F3A, MGC87783, H3.3A, MGC87782, H3F3, H3.3B, H3F3B |
| Formule | Anti-trimethyl-Histone H3 (Lys27) (rabbit polyclonal IgG). One vial containing 100μg protein A purified IgG in 100μL buffer containing 0.1 M Tris-Glycine, pH 7.4, 0.15M NaCl with 0.05% sodium azide. Normal Rabbit IgG. One vial containing 125μg purified Rabbit IgG in 125μL storage buffer containing 0.1% sodium azide. ChIP Primers human alpha-Satellite. One vial containing 75μL of 5μM of each control primer specific for human alpha-Satellite. FOR: CTG CAC TAC CTG AAG AGG AC; REV: GAT GGT TCA ACA CTC TTA CA |
| Antigène | Trimethyl-Histone H3 (Lys27) |
MilliporeSigma™ RIPAb+™ FXR1 RIP Validated Antibody and Primer Set
This RIPAb+ FXR1 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Invitrogen™ eBioscience™ ProcartaPlex Human Th1/Th2 & Chemokine Panel 1 (20 plex)
Ideal solution for assessing multiple protein biomarkers in a single sample. Explore our broad portfolio of pre-configurated panels and combinable single analytes.
| Applications | ChIP Assay,Dot Blot,Functional Assay,Western Blot |
|---|---|
| Spécificité du test | Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa. |
| Isotype | IgG |
| Primaire ou secondaire | Primary |
| Contenu et stockage | -20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles |
| Forme | Purified |
| État réglementaire | RUO |
| Numéro d’ordre du gène | Q16695 |
| Immunogène | KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36). |
| Classification | Monoclonal |
| Comprend | This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers. |
| Identification génétique (Entrez) | NP_003484 |
| Méthode de purification | Protein A purified |
| Espèces hôtes | Rabbit |
| Symboles de gène(s) | H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945 |
| Formule | Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT |
| Antigène | Trimethyl-Histone H3 (Lys36)α |
MilliporeSigma™ RIPAb+™ HuR RIP Validated Antibody and Primer Set
This RIPAb+ HuR -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
| Applications | ChIP Assay,ChIP sequencing (ChIP-seq),Western Blot |
|---|---|
| Spécificité du test | Trimethyl-Histone H3 (Lys4) |
| Isotype | IgG |
| Primaire ou secondaire | Primary |
| Contenu et stockage | −20°C for one year from date of shipment |
| Forme | Purified |
| État réglementaire | RUO |
| Numéro d’ordre du gène | Q66I33 |
| Immunogène | The trimethyl-histone H3 (Lys4) antibody is made against a BSA-conjugated,synthetic peptide containing the sequence …RT[me3K]QT… in which me3K corresponds to trimethyl-lysine 4 of human histone H3 |
| Classification | Monoclonal |
| Comprend | Trimethyl-Histone H3 (Lys4) ChIP validated Antibody and Primer set including the ChIP-grade antibody and the specific control PCR primers used for chromatin immunoprecipitation of H3K4Me3. |
| Identification génétique (Entrez) | NM_003493 |
| Espèces hôtes | Rabbit |
| Symboles de gène(s) | H3F3A, H3F3B, H3F3 |
| Formule | Anti-Trimethyl-Histone H3 (Lys4) recombin-ant rabbit monoclonal IgG. One vial containing 75μL of protein A purified rabbit IgG in storage buffer (0.1M Tris-Glycine pH 7.4, 0.15M NaCl, 0.05% NaN3, with the addition of 40% glycerol. Normal Rabbit IgG. One vial containing 75μL of normal rabbit IgG. Control Primers. One vial containing 75μL of 5μM of each primer specific for human GAPDH. FOR: TAC TAG CGG TTT TAC GGG CG REV: TCG AAC AGG AGG AGC AGA GAG CGA |
| Antigène | Trimethyl-Histone H3 (Lys4)α |
MilliporeSigma™ Upstate™ Acetyl-Histone H4, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set
Rabbit Polyclonal Antibody
| Applications | Multiplex,Functional Assay,Immunoassay,Western Blot |
|---|---|
| Spécificité du test | Recognizes acetylated histone H4 of approximately 10kDa. Cross-reacts with acetylated histone H2B from Tetrahymena and weakly crossreacts with acetylated histone H2B from HeLa cells. May cross-react with other acetylated proteins. |
| Primaire ou secondaire | Primary |
| Contenu et stockage | −20°C from date of receipt |
| Forme | Serum |
| État réglementaire | RUO |
| Numéro d’ordre du gène | P62805 |
| Immunogène | The acetyl-histone H4 antiserum is made against a peptide corresponding to amino acids 2-19 of Tetrahymena histone H4. |
| Classification | Polyclonal |
| Comprend | This ChIPAb+ Acetyl-Histone H4 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers. |
| Identification génétique (Entrez) | NP_778224 |
| Espèces hôtes | Rabbit |
| Formule | Anti-Acetyl-Histone H4 (rabbit polyclonal IgG). One vial containing 100μL of antiserum containing 0.05% sodium azide. Normal Rabbit Serum. One vial containing 100μL antiserum containing 0.05% sodium azide. Control Primers. One vial containing 75μL of 5μM of each primer specific for for human GAPDH. |
| Antigène | Acetyl-Histone H4 |
MilliporeSigma™ Upstate ChIPAb+ REST - ChIP Validated Antibody and Primer Set
REST purified antibody against GST fusion protein corresponding to amino acids 801-1097 of human REST
| Applications | ChIP Assay,Western Blot |
|---|---|
| Spécificité du test | Recognizes histone H4, Mr ∽11kDa. |
| Primaire ou secondaire | Primary |
| Contenu et stockage | -20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles |
| État réglementaire | RUO |
| Numéro d’ordre du gène | P62805 |
| Immunogène | The immunogen was a synthetic peptide corresponding to amino acids 15-24 of histone H4,monomethylated on Lys20. |
| Classification | Polyclonal |
| Comprend | This ChIPAb+ Monomethyl-Histone H4 (Lys20) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers. |
| Identification génétique (Entrez) | NM_003538.3 |
| Méthode de purification | Affinity Purified |
| Espèces hôtes | Rabbit |
| Symboles de gène(s) | H4/A , H4/B, H4/C , H4/D, H4/E, H4/G, H4/H, H4/I, H4/J, H4/J, H4/M, H4/N, H4/O , H4/a , H4F2, H4FA , H4FB , H4FC , H4FD, H4FE, H4FG, H4FH, H4FI , H4FJ, H4FK, H4FM , H4FN, H4FO, HIST2H4 |
| Formule | Anti-monomethyl-Histone H4 (Lys20) (rabbit polyclonal IgG). One vial containing 100μg of affinity purified antibody in 100μL 0.1M Tris-Glycine (pH 7.4), 15mM NaCl, and 0.05% NaN3. Normal Rabbit IgG. One vial containing 125μg of purified rabbit IgG in 125μL storage buffer. ChIP Primers GAPDH Coding Region. One vial containing 75μL of 5μM of each primer specific for human GAPDH coding region. FOR: GGC TCC CAC CTT TCT CAT CC; REV: GGC CAT CCA CAG TCT TCT GG |
| Antigène | Monomethyl-Histone H4 (Lys20) |
MilliporeSigma™ Upstate™ EEDα, Mouse monoclonal, ChIP Validated Antibody and Primer Set
Mouse Monoclonal Antibody
| Applications | ChIP Assay,Western Blot |
|---|---|
| Spécificité du test | Recognizes EED, MW: ∽50kDa. |
| Isotype | IgG2a κ |
| Primaire ou secondaire | Primary |
| Contenu et stockage | -20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles |
| Forme | Purified |
| État réglementaire | RUO |
| Numéro d’ordre du gène | O75530 |
| Immunogène | Recombinant fusion protein of full length murine EED tagged with MBP. |
| Classification | Monoclonal |
| Comprend | This ChIPAb+ EED -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers. |
| Identification génétique (Entrez) | NP_003788 |
| Espèces hôtes | Mouse |
| Symboles de gène(s) | EED; WAIT-1 |
| Formule | Anti-EED (Mouse monoclonal IgG). One vial containing 50μg of protein G purified antibody in 0.1 M Tris-Glycine (pH 7.4) 150mM NaCl, containing 0.05% azide. May contain 30% glycerol (see certificate of analysis for details). Normal mouse IgG. Two vials containing 25μg of purified mouse IgG in 25μL of storage buffer containing 0.1% sodium azide. ChIP Primers, HoxA2 upstream. One vial containing 75μL of 5μM of each primer specific for the promoter region of human HoxA2. FOR: AGG AAA GAT TTT GGT TGG GAA G; REV: AAA AAG AGG GAA AGG GAC AGA C |
| Antigène | EEDα |
MilliporeSigma™ Upstate™ E2F-1α, Mouse monoclonal, ChIP Validated Antibody and Primer Set
Mouse Monoclonal Antibody
| Applications | ChIP Assay,ChIP sequencing (ChIP-seq),Immunoprecipitation |
|---|---|
| Spécificité du test | The epitopes have been mapped to amino acids 1 to 89 and to amino acids 342 to 386. |
| Isotype | IgG |
| Primaire ou secondaire | Primary |
| Contenu et stockage | -20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles |
| Forme | Purified |
| État réglementaire | RUO |
| Numéro d’ordre du gène | Q01094 |
| Immunogène | GST fusion protein corresponding to full-length human E2F-1. |
| Classification | Monoclonal |
| Comprend | This ChIPAb+ E2F-1 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers. |
| Identification génétique (Entrez) | NP_005216 |
| Méthode de purification | Protein G purified |
| Espèces hôtes | Mouse |
| Symboles de gène(s) | E2F1, RBAP-1, E2F-1, RBP3, RBBP3, RBBP-3, PBR3 |
| Formule | Anti-E2F-1 (mouse monoclonal). One vial containing 25μg of protein G purified monoclonal mixed IgG in 25μL of buffer containing 0.1 M Tris-glycine, pH 7.4, 0.15 M NaCl with 0.05% sodium azide. Frozen solution. Nornal Mouse IgG. One vial containing 25μg of purified IgG in 25μL of storage buffer containing 0.1% sodium azide. ChIP Primers, CDC2 promoter. One vial containing 75μL of 5μM each primer specific for human CDC2 promoter. FOR: CGC CCT TTC CTC TTT CTT TC; REV: ATC GGG TAG CCC GTA GAC TT |
| Antigène | E2F-1α |