accessibility menu, dialog, popup

UserName

Antibody Panels and Kits

Combinations of antibody-related products that may include sets of antibodies in pairs and cocktails, control particles, buffers, and other kits and panels; for use in specific applications such as immunoassays and T-cell activation.
Quantité 
  • (1)
  • (1)
  • (8)
  • (24)
  • (1)
  • (3)
  • (1)
  • (11)
  • (1)
  • (3)
  • (1)
  • (1)
  • (1)
  • (2)
Applications 
  • (10)
  • (2)
  • (8)
  • (2)
  • (10)
  • (2)
  • (1)
  • (7)
  • (3)
  • (2)
  • (28)
  • (2)
  • (36)
Classification 
  • (34)
  • (18)
Espèces hôtes 
  • (1)
  • (6)
  • (1)
  • (23)
  • (13)
  • (8)
Espèces cibles 
  • (1)
  • (5)
  • (3)
  • (2)
  • (6)
  • (6)
  • (1)
  • (1)
  • (1)
  • (44)
  • (7)
  • (2)
  • (7)
  • (19)
  • (6)
  • (1)
  • (1)
  • (2)
  • (10)
  • (7)
  • (1)
  • (1)
  • (4)
  • (1)
  • (2)

Résultats de la recherche filtrée

Les produits de certains de nos fournisseurs ne s'affichent pas dans les résultats de la recherche filtrée. Veuillez supprimer tous les filtres pour voir ces produits.

Affiner les résultats

Affiner les résultats

catégorie

marques

  • (15)
  • (37)
  • (7)
  • (1)

Quantité

  • (1)
  • (1)
  • (8)
  • (24)
  • (1)
  • (3)
  • (1)
  • (11)
  • (1)
  • (3)
  • (1)
  • (1)
  • (1)
  • (2)

Applications

  • (10)
  • (2)
  • (8)
  • (2)
  • (10)
  • (2)
  • (1)
  • (7)
  • (3)
  • (2)
  • (28)
  • (2)
  • (36)

Classification

  • (34)
  • (18)

Espèces hôtes

  • (1)
  • (6)
  • (1)
  • (23)
  • (13)
  • (8)

Espèces cibles

  • (1)
  • (5)
  • (3)
  • (2)
  • (6)
  • (6)
  • (1)
  • (1)
  • (1)
  • (44)
  • (7)
  • (2)
  • (7)
  • (19)
  • (6)
  • (1)
  • (1)
  • (2)
  • (10)
  • (7)
  • (1)
  • (1)
  • (4)
  • (1)
  • (2)

Forme

  • (2)
  • (1)
  • (1)
  • (7)
  • (28)
  • (2)

Isotype

  • (5)
  • (3)
  • (8)
  • (2)
  • (12)
  • (1)
  • (3)

Conjugué

  • (3)
  • (1)
  • (3)
  • (2)
  • (1)
  • (5)
  • (3)
  • (11)

État réglementaire

  • (29)

Rechercher dans les résultats
Recherche par mot-clé:
1 – 15 de 59 résultats
1

MilliporeSigma™ RIPAb+™ Upf1 RIP Validated Antibody and Primer Set

This RIPAb+ Upf1 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

2

MilliporeSigma™ RIPAb+™ EED RIP Validated Antibody and Primer Set

This RIPAb+ EED -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

3

MilliporeSigma™ RIPAb+™ IGF2 mRNA-Binding Protein 3 RIP Validated Antibody and Primer Set

This RIPAb+ IGF2 mRNA-binding protein 3 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

4

MilliporeSigma™ RIPAb+™ AUF1 RIP Validated Antibody and Primer Set

This RIPAb+ AUF1 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

7

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys36)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Applications ChIP Assay,Dot Blot,Functional Assay,Western Blot
Spécificité du test Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa.
Isotype IgG
Primaire ou secondaire Primary
Contenu et stockage -20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Forme Purified
État réglementaire RUO
Numéro d’ordre du gène Q16695
Immunogène KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36).
Classification Monoclonal
Comprend This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Identification génétique (Entrez) NP_003484
Méthode de purification Protein A purified
Espèces hôtes Rabbit
Symboles de gène(s) H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Formule Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT
Antigène Trimethyl-Histone H3 (Lys36)α
8

MilliporeSigma™ Upstate™ Acetyl-Histone H4 (Lys5)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Applications ChIP Assay,Immunoprecipitation,Western Blot
Spécificité du test Recognizes Histone H4 acetylated on Lys5.
Isotype IgG
Primaire ou secondaire Primary
Contenu et stockage -20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Forme Culture Supernatant
État réglementaire RUO
Numéro d’ordre du gène P62805
Immunogène Peptide corresponding to Histone H4 containing the sequence [GRG-AcK-GGK] on which Lys5 is acetylated.
Classification Monoclonal
Comprend This ChIPAb+ Acetyl-Histone H4 (Lys5) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Identification génétique (Entrez) NP_001029249
Espèces hôtes Rabbit
Symboles de gène(s) HIST1H4A, H4/J, HIST1H4F, HIST1H4L, H4FN, H4FA, H4FH, HIST1H4H, H4F2, H4FM, H4/A, H4FK, H4FG, HIST2H4, H4FB, H4/K, HIST1H4I, H4/N, HIST1H4B, H4FE, H4/M, H4/a, HIST1H4E, HIST4H4, HIST2H4A, H4FC, H4FI, H4/H, HIST1H4C, H4/G, HIST1H4K, H4FJ, H4FD, H4/I, H4/B, H4/D, H4/C, HIST1H4J, HIST1H4D, H4/E
Formule Anti-Acetyl-Histone H4 (Lys5) (rabbit monoclonal IgG). One vial containing 50μL of rabbit monoclonal IgG cell culture supernatant in 0.1% sodium azide. Negative Control Supernatant (rabbit). One vial containing 50μL of cultured supernatant in 0.05% sodium azide. Control Primers. One vial containing 75μL of 5μM each primer specific for the human GAPDH promoter. FOR: TAC TAG CGG TTT TAC GGG CG; REV: TCG AAC AGG AGG AGC AGA GAG CGA
Antigène Acetyl-Histone H4 (Lys5)α
9

MilliporeSigma™ RIPAb+™ SUZ12 RIP Validated Antibody and Primer Set

This RIPAb+ SUZ12 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

10

MilliporeSigma™ Upstate™ Monomethyl-Histone H4 (Lys20), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Applications ChIP Assay,Western Blot
Spécificité du test Recognizes histone H4, Mr ∽11kDa.
Primaire ou secondaire Primary
Contenu et stockage -20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
État réglementaire RUO
Numéro d’ordre du gène P62805
Immunogène The immunogen was a synthetic peptide corresponding to amino acids 15-24 of histone H4,monomethylated on Lys20.
Classification Polyclonal
Comprend This ChIPAb+ Monomethyl-Histone H4 (Lys20) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Identification génétique (Entrez) NM_003538.3
Méthode de purification Affinity Purified
Espèces hôtes Rabbit
Symboles de gène(s) H4/A , H4/B, H4/C , H4/D, H4/E, H4/G, H4/H, H4/I, H4/J, H4/J, H4/M, H4/N, H4/O , H4/a , H4F2, H4FA , H4FB , H4FC , H4FD, H4FE, H4FG, H4FH, H4FI , H4FJ, H4FK, H4FM , H4FN, H4FO, HIST2H4
Formule Anti-monomethyl-Histone H4 (Lys20) (rabbit polyclonal IgG). One vial containing 100μg of affinity purified antibody in 100μL 0.1M Tris-Glycine (pH 7.4), 15mM NaCl, and 0.05% NaN3. Normal Rabbit IgG. One vial containing 125μg of purified rabbit IgG in 125μL storage buffer. ChIP Primers GAPDH Coding Region. One vial containing 75μL of 5μM of each primer specific for human GAPDH coding region. FOR: GGC TCC CAC CTT TCT CAT CC; REV: GGC CAT CCA CAG TCT TCT GG
Antigène Monomethyl-Histone H4 (Lys20)
11

MilliporeSigma™ RIPAb+™ Ago3 RIP Validated Antibody and Primer Set

This RIPAb+ Ago3 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

12

MilliporeSigma™ RIPAb+™ FXR1 RIP Validated Antibody and Primer Set

This RIPAb+ FXR1 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

13

MilliporeSigma™ RIPAb+™ hnRNPA1 (M9 Region) RIP Validated Antibody and Primer Set

This RIPAb+ hnRNPA1 (M9 Region) -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

14

MilliporeSigma™ RIPAb+™ Ago2 RIP Validated Antibody and Primer Set

This RIPAb+ Ago2 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

15

MilliporeSigma™ RIPAb+™ PABPC1 RIP Validated Antibody and Primer Set

This RIPAb+ PABPC1 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.