Antibody Panels and Kits
Combinations of antibody-related products that may include sets of antibodies in pairs and cocktails, control particles, buffers, and other kits and panels; for use in specific applications such as immunoassays and T-cell activation.
Quantity
- (1)
- (1)
- (8)
- (24)
- (1)
- (3)
- (1)
- (11)
- (1)
- (3)
- (1)
- (1)
- (1)
- (2)
Applications
- (10)
- (2)
- (8)
- (2)
- (10)
- (2)
- (1)
- (7)
- (3)
- (2)
- (28)
- (2)
- (36)
Classification
- (34)
- (18)
Host Species
- (1)
- (6)
- (1)
- (23)
- (13)
- (8)
Target Species
- (1)
- (5)
- (3)
- (2)
- (6)
- (6)
- (1)
- (1)
- (1)
- (44)
- (7)
- (2)
- (7)
- (19)
- (6)
- (1)
- (1)
- (2)
- (10)
- (7)
- (1)
- (1)
- (4)
- (1)
- (2)
Filtered Search Results
Products from some of our suppliers do not display in filtered search results. Please
clear all filters
to see these products.
Search Within Results
Keyword Search:
Clear All
1
–
15
of
59
results
| Content And Storage | -20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles |
|---|---|
| Host Species | Rabbit |
| Applications | ChIP Assay,Dot Blot,Functional Assay,Western Blot |
| Form | Purified |
| Gene Accession No. | Q16695 |
| Isotype | IgG |
| Includes | This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers. |
| Antigen | Trimethyl-Histone H3 (Lys36)α |
| Regulatory Status | RUO |
| Gene Symbols | H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945 |
| Purification Method | Protein A purified |
| Gene ID (Entrez) | NP_003484 |
| Formulation | Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT |
| Immunogen | KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36). |
| Classification | Monoclonal |
| Primary or Secondary | Primary |
| Test Specificity | Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa. |
| Content And Storage | −20°C for one year from date of shipment |
|---|---|
| Host Species | Rabbit |
| Applications | ChIP Assay,ChIP sequencing (ChIP-seq),Western Blot |
| Form | Purified |
| Gene Accession No. | Q66I33 |
| Isotype | IgG |
| Includes | Trimethyl-Histone H3 (Lys4) ChIP validated Antibody and Primer set including the ChIP-grade antibody and the specific control PCR primers used for chromatin immunoprecipitation of H3K4Me3. |
| Antigen | Trimethyl-Histone H3 (Lys4)α |
| Regulatory Status | RUO |
| Gene Symbols | H3F3A, H3F3B, H3F3 |
| Gene ID (Entrez) | NM_003493 |
| Formulation | Anti-Trimethyl-Histone H3 (Lys4) recombin-ant rabbit monoclonal IgG. One vial containing 75μL of protein A purified rabbit IgG in storage buffer (0.1M Tris-Glycine pH 7.4, 0.15M NaCl, 0.05% NaN3, with the addition of 40% glycerol. Normal Rabbit IgG. One vial containing 75μL of normal rabbit IgG. Control Primers. One vial containing 75μL of 5μM of each primer specific for human GAPDH. FOR: TAC TAG CGG TTT TAC GGG CG REV: TCG AAC AGG AGG AGC AGA GAG CGA |
| Immunogen | The trimethyl-histone H3 (Lys4) antibody is made against a BSA-conjugated,synthetic peptide containing the sequence …RT[me3K]QT… in which me3K corresponds to trimethyl-lysine 4 of human histone H3 |
| Classification | Monoclonal |
| Primary or Secondary | Primary |
| Test Specificity | Trimethyl-Histone H3 (Lys4) |
| Content And Storage | -20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles |
|---|---|
| Host Species | Rabbit |
| Applications | ChIP Assay,Western Blot |
| Gene Accession No. | P62805 |
| Includes | This ChIPAb+ Monomethyl-Histone H4 (Lys20) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers. |
| Antigen | Monomethyl-Histone H4 (Lys20) |
| Regulatory Status | RUO |
| Gene Symbols | H4/A , H4/B, H4/C , H4/D, H4/E, H4/G, H4/H, H4/I, H4/J, H4/J, H4/M, H4/N, H4/O , H4/a , H4F2, H4FA , H4FB , H4FC , H4FD, H4FE, H4FG, H4FH, H4FI , H4FJ, H4FK, H4FM , H4FN, H4FO, HIST2H4 |
| Purification Method | Affinity Purified |
| Gene ID (Entrez) | NM_003538.3 |
| Formulation | Anti-monomethyl-Histone H4 (Lys20) (rabbit polyclonal IgG). One vial containing 100μg of affinity purified antibody in 100μL 0.1M Tris-Glycine (pH 7.4), 15mM NaCl, and 0.05% NaN3. Normal Rabbit IgG. One vial containing 125μg of purified rabbit IgG in 125μL storage buffer. ChIP Primers GAPDH Coding Region. One vial containing 75μL of 5μM of each primer specific for human GAPDH coding region. FOR: GGC TCC CAC CTT TCT CAT CC; REV: GGC CAT CCA CAG TCT TCT GG |
| Immunogen | The immunogen was a synthetic peptide corresponding to amino acids 15-24 of histone H4,monomethylated on Lys20. |
| Classification | Polyclonal |
| Primary or Secondary | Primary |
| Test Specificity | Recognizes histone H4, Mr ∽11kDa. |
MilliporeSigma™ RIPAb+™ CUGBP2 RIP Validated Antibody and Primer Set
This RIPAb+ CUGBP2 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
MilliporeSigma™ RIPAb+™ hnRNP U RIP Validated Antibody and Primer Set
This RIPAb+ hnRNP U -RIP Validated Antibody and Primer Set conveniently includes the hnRNP U antibody and the specific control PCR primers.
MilliporeSigma™ RIPAb+™ pan Ago RIP Validated Antibody and Primer Set
This RIPAb+ pan Ago -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
| Content And Storage | -20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles |
|---|---|
| Host Species | Rabbit |
| Applications | ChIP Assay,Immunoprecipitation,Western Blot |
| Form | Serum |
| Gene Accession No. | P62805 |
| Includes | The ChIPAb+ Acetyl-Histone H4 (Lys8) set includes the Acetyl-Histone H4 (Lys8) antibody, a negative control rabbit serum and qPCR primers which amplify a 134bp region of human HSPCA. |
| Antigen | Acetyl-Histone H4 (Lys8) |
| Regulatory Status | RUO |
| Gene Symbols | HIST1H4A, H4/J, HIST1H4F, HIST1H4L, H4FN, H4FA, H4FH, HIST1H4H, H4F2, H4FM, H4/A, H4FK, H4FG, HIST2H4, H4FB, H4/K, HIST1H4I, H4/N, HIST1H4B, H4FE, H4/M, H4/a, HIST1H4E, HIST4H4, HIST2H4A, H4FC, H4FI, H4/H, HIST1H4C, H4/G, HIST1H4K, H4FJ, H4FD, H4/I, H4/B, H4/D, H4/C, HIST1H4J, HIST1H4D, H4/E |
| Purification Method | Unpurified |
| Gene ID (Entrez) | NM_175054 |
| Formulation | Anti-Acetyl-Histone H4 (Lys8) (rabbit polyclonal). One vial containing 50μL of antiserum containing 0.05% sodium azide. Normal Rabbit Serum. One vial containing 100μL of antiserum containing 0.05% sodium azide. ChIP Primers, HSPCA. One vial containing 75μL of 5μM of each primer specific for human HSPCA. FOR: GCA ACA GCT ACC ACA GGA CCA; REV: GAG CGT GTG AAA TCA ACA TAA AGC |
| Immunogen | Synthetic peptide corresponding to yeast Histone H4 acetylated at lysine 8. |
| Classification | Polyclonal |
| Primary or Secondary | Primary |
| Test Specificity | Recognizes acetyl-Histone H4 (Lys8). |
MilliporeSigma™ Upstate™ HDAC3 Mouse monoclonal, ChIP Validated Antibody and Primer Set
Mouse Monoclonal Antibody
| Content And Storage | -20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles |
|---|---|
| Host Species | Mouse |
| Applications | ChIP Assay,Western Blot |
| Form | Purified |
| Gene Accession No. | O15379 |
| Isotype | IgG2a |
| Includes | This ChIPAb+ HDAC3 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers. |
| Antigen | HDAC3 |
| Regulatory Status | RUO |
| Gene Symbols | HDAC3, SMAP45, HD3, RPD3, RPD3-2 |
| Gene ID (Entrez) | NM_003883 |
| Formulation | Anti-HDAC3 (mouse monoclonal). One vial containing 100μg of protein G purified monoclonal in buffer containing 0.02M phosphate buffer (pH 7.6), 0.25M NaCl, 0.1% sodium azide and 30% glycerol. Concentration: 1mg/mL. Normal Mouse IgG. One vial containing 125μg of purified mouse IgG in 125μL of storage buffer containing 0.1% sodium azide. ChIP Primers, p21. One vial containing 75μL of each primer (5μM) specific for a region of the human p21 (WAF1/CIP1/CDKN1A) promoter. FOR: CCC ACA GCA GAG GAG AAA GAA; REV: CTG GAA ATC TCT GCC CAG ACA |
| Immunogen | peptide (NEFYDGDHDNDKESDVEI) corresponding to amino acids 411-428 of human HDAC3 |
| Classification | Monoclonal |
| Primary or Secondary | Primary |
MilliporeSigma™ RIPAb+™ Ago1 RIP Validated Antibody and Primer Set
This RIPAb+ Ago1 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.