Antibody Panels and Kits

Combinations of antibody-related products that may include sets of antibodies in pairs and cocktails, control particles, buffers, and other kits and panels; for use in specific applications such as immunoassays and T-cell activation.

Rechercher dans les résultats

1 – 15 de 59 résultats

MilliporeSigma™ RIPAb+™ PABPC1 RIP Validated Antibody and Primer Set

This RIPAb+ PABPC1 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

Prix et disponibilité

Anti-Human Foxp3 Staining Set PE, eBioscience™

Antibody Staining Kit

Prix et disponibilité

MilliporeSigma™ RIPAb+™ SUZ12 RIP Validated Antibody and Primer Set

This RIPAb+ SUZ12 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

Prix et disponibilité

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys36)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Prix et disponibilité
Spécifications

Applications	ChIP Assay,Dot Blot,Functional Assay,Western Blot
Spécificité du test	Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa.
Isotype	IgG
Primaire ou secondaire	Primary
Contenu et stockage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Forme	Purified
État réglementaire	RUO
Numéro d’ordre du gène	Q16695
Immunogène	KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36).
Classification	Monoclonal
Comprend	This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Identification génétique (Entrez)	NP_003484
Méthode de purification	Protein A purified
Espèces hôtes	Rabbit
Symboles de gène(s)	H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Formule	Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT
Antigène	Trimethyl-Histone H3 (Lys36)α

MilliporeSigma™ RIPAb+™ IGF2 mRNA-Binding Protein 3 RIP Validated Antibody and Primer Set

This RIPAb+ IGF2 mRNA-binding protein 3 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

Prix et disponibilité

Anti-Human Foxp3 Staining Set Alexa Fluor™ 488 , eBioscience™

Antibody Staining Kit

Prix et disponibilité

MilliporeSigma™ Upstate™ Acetyl-Histone H4 (Lys8), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Prix et disponibilité
Spécifications

Applications	ChIP Assay,Immunoprecipitation,Western Blot
Spécificité du test	Recognizes acetyl-Histone H4 (Lys8).
Primaire ou secondaire	Primary
Contenu et stockage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Forme	Serum
État réglementaire	RUO
Numéro d’ordre du gène	P62805
Immunogène	Synthetic peptide corresponding to yeast Histone H4 acetylated at lysine 8.
Classification	Polyclonal
Comprend	The ChIPAb+ Acetyl-Histone H4 (Lys8) set includes the Acetyl-Histone H4 (Lys8) antibody, a negative control rabbit serum and qPCR primers which amplify a 134bp region of human HSPCA.
Identification génétique (Entrez)	NM_175054
Méthode de purification	Unpurified
Espèces hôtes	Rabbit
Symboles de gène(s)	HIST1H4A, H4/J, HIST1H4F, HIST1H4L, H4FN, H4FA, H4FH, HIST1H4H, H4F2, H4FM, H4/A, H4FK, H4FG, HIST2H4, H4FB, H4/K, HIST1H4I, H4/N, HIST1H4B, H4FE, H4/M, H4/a, HIST1H4E, HIST4H4, HIST2H4A, H4FC, H4FI, H4/H, HIST1H4C, H4/G, HIST1H4K, H4FJ, H4FD, H4/I, H4/B, H4/D, H4/C, HIST1H4J, HIST1H4D, H4/E
Formule	Anti-Acetyl-Histone H4 (Lys8) (rabbit polyclonal). One vial containing 50μL of antiserum containing 0.05% sodium azide. Normal Rabbit Serum. One vial containing 100μL of antiserum containing 0.05% sodium azide. ChIP Primers, HSPCA. One vial containing 75μL of 5μM of each primer specific for human HSPCA. FOR: GCA ACA GCT ACC ACA GGA CCA; REV: GAG CGT GTG AAA TCA ACA TAA AGC
Antigène	Acetyl-Histone H4 (Lys8)

MilliporeSigma™ Upstate™ HDAC3 Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Prix et disponibilité
Spécifications

Applications	ChIP Assay,Western Blot
Isotype	IgG2a
Primaire ou secondaire	Primary
Contenu et stockage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Forme	Purified
État réglementaire	RUO
Numéro d’ordre du gène	O15379
Immunogène	peptide (NEFYDGDHDNDKESDVEI) corresponding to amino acids 411-428 of human HDAC3
Classification	Monoclonal
Comprend	This ChIPAb+ HDAC3 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Identification génétique (Entrez)	NM_003883
Espèces hôtes	Mouse
Symboles de gène(s)	HDAC3, SMAP45, HD3, RPD3, RPD3-2
Formule	Anti-HDAC3 (mouse monoclonal). One vial containing 100μg of protein G purified monoclonal in buffer containing 0.02M phosphate buffer (pH 7.6), 0.25M NaCl, 0.1% sodium azide and 30% glycerol. Concentration: 1mg/mL. Normal Mouse IgG. One vial containing 125μg of purified mouse IgG in 125μL of storage buffer containing 0.1% sodium azide. ChIP Primers, p21. One vial containing 75μL of each primer (5μM) specific for a region of the human p21 (WAF1/CIP1/CDKN1A) promoter. FOR: CCC ACA GCA GAG GAG AAA GAA; REV: CTG GAA ATC TCT GCC CAG ACA
Antigène	HDAC3

MilliporeSigma™ Acetyl-Histone H4 Antibody Set

Prix et disponibilité

Anti-Mouse/Rat Foxp3 Staining Set FITC, eBioscience™

Antibody Staining Kit

Prix et disponibilité

Anti-Human Foxp3 Staining Set FITC, eBioscience™

Antibody Staining Kit

Prix et disponibilité

MilliporeSigma™ Upstate™ E2F-1α, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Prix et disponibilité
Spécifications

Applications	ChIP Assay,ChIP sequencing (ChIP-seq),Immunoprecipitation
Spécificité du test	The epitopes have been mapped to amino acids 1 to 89 and to amino acids 342 to 386.
Isotype	IgG
Primaire ou secondaire	Primary
Contenu et stockage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Forme	Purified
État réglementaire	RUO
Numéro d’ordre du gène	Q01094
Immunogène	GST fusion protein corresponding to full-length human E2F-1.
Classification	Monoclonal
Comprend	This ChIPAb+ E2F-1 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Identification génétique (Entrez)	NP_005216
Méthode de purification	Protein G purified
Espèces hôtes	Mouse
Symboles de gène(s)	E2F1, RBAP-1, E2F-1, RBP3, RBBP3, RBBP-3, PBR3
Formule	Anti-E2F-1 (mouse monoclonal). One vial containing 25μg of protein G purified monoclonal mixed IgG in 25μL of buffer containing 0.1 M Tris-glycine, pH 7.4, 0.15 M NaCl with 0.05% sodium azide. Frozen solution. Nornal Mouse IgG. One vial containing 25μg of purified IgG in 25μL of storage buffer containing 0.1% sodium azide. ChIP Primers, CDC2 promoter. One vial containing 75μL of 5μM each primer specific for human CDC2 promoter. FOR: CGC CCT TTC CTC TTT CTT TC; REV: ATC GGG TAG CCC GTA GAC TT
Antigène	E2F-1α

Anti-Human Foxp3 Staining Set APC, eBioscience™

Antibody Staining Kit

Prix et disponibilité

Anti-Human Foxp3 Staining Set APC, eBioscience™

Antibody Staining Kit

Prix et disponibilité

MilliporeSigma™ Upstate™ EEDα, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Prix et disponibilité
Spécifications

Applications	ChIP Assay,Western Blot
Spécificité du test	Recognizes EED, MW: ∽50kDa.
Isotype	IgG2a κ
Primaire ou secondaire	Primary
Contenu et stockage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Forme	Purified
État réglementaire	RUO
Numéro d’ordre du gène	O75530
Immunogène	Recombinant fusion protein of full length murine EED tagged with MBP.
Classification	Monoclonal
Comprend	This ChIPAb+ EED -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Identification génétique (Entrez)	NP_003788
Espèces hôtes	Mouse
Symboles de gène(s)	EED; WAIT-1
Formule	Anti-EED (Mouse monoclonal IgG). One vial containing 50μg of protein G purified antibody in 0.1 M Tris-Glycine (pH 7.4) 150mM NaCl, containing 0.05% azide. May contain 30% glycerol (see certificate of analysis for details). Normal mouse IgG. Two vials containing 25μg of purified mouse IgG in 25μL of storage buffer containing 0.1% sodium azide. ChIP Primers, HoxA2 upstream. One vial containing 75μL of 5μM of each primer specific for the promoter region of human HoxA2. FOR: AGG AAA GAT TTT GGT TGG GAA G; REV: AAA AAG AGG GAA AGG GAC AGA C
Antigène	EEDα

Antibody Panels and Kits

Résultats de la recherche filtrée

Affiner les résultats