Antibody Panels and Kits

Combinations of antibody-related products that may include sets of antibodies in pairs and cocktails, control particles, buffers, and other kits and panels; for use in specific applications such as immunoassays and T-cell activation.

1 – 15 of 59 results

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys36)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Pricing and Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Dot Blot,Functional Assay,Western Blot
Form	Purified
Gene Accession No.	Q16695
Isotype	IgG
Includes	This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Trimethyl-Histone H3 (Lys36)α
Regulatory Status	RUO
Gene Symbols	H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Purification Method	Protein A purified
Gene ID (Entrez)	NP_003484
Formulation	Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT
Immunogen	KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36).
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa.

Foxp3 Rat, PE, Clone: PCH101, Staining Set, eBioscience™

Antibody Staining Kit

Pricing and Availability

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys4)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Pricing and Availability
Specifications

Content And Storage	−20°C for one year from date of shipment
Host Species	Rabbit
Applications	ChIP Assay,ChIP sequencing (ChIP-seq),Western Blot
Form	Purified
Gene Accession No.	Q66I33
Isotype	IgG
Includes	Trimethyl-Histone H3 (Lys4) ChIP validated Antibody and Primer set including the ChIP-grade antibody and the specific control PCR primers used for chromatin immunoprecipitation of H3K4Me3.
Antigen	Trimethyl-Histone H3 (Lys4)α
Regulatory Status	RUO
Gene Symbols	H3F3A, H3F3B, H3F3
Gene ID (Entrez)	NM_003493
Formulation	Anti-Trimethyl-Histone H3 (Lys4) recombin-ant rabbit monoclonal IgG. One vial containing 75μL of protein A purified rabbit IgG in storage buffer (0.1M Tris-Glycine pH 7.4, 0.15M NaCl, 0.05% NaN3, with the addition of 40% glycerol. Normal Rabbit IgG. One vial containing 75μL of normal rabbit IgG. Control Primers. One vial containing 75μL of 5μM of each primer specific for human GAPDH. FOR: TAC TAG CGG TTT TAC GGG CG REV: TCG AAC AGG AGG AGC AGA GAG CGA
Immunogen	The trimethyl-histone H3 (Lys4) antibody is made against a BSA-conjugated,synthetic peptide containing the sequence …RT[me3K]QT… in which me3K corresponds to trimethyl-lysine 4 of human histone H3
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Trimethyl-Histone H3 (Lys4)

Invitrogen™ TGF beta Human Matched Antibody Pair

Matched Antibody Pair

Pricing and Availability

Invitrogen™ ELISA Assay Buffer (5X)

For use with antibody pairs (ELISA)

Pricing and Availability

MilliporeSigma™ RIPAb+™ Ago2 RIP Validated Antibody and Primer Set

This RIPAb+ Ago2 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

Pricing and Availability

MilliporeSigma™ RIPAb+™ AUF1 RIP Validated Antibody and Primer Set

This RIPAb+ AUF1 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

Pricing and Availability

MilliporeSigma™ Upstate™ HDAC3 Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing and Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Mouse
Applications	ChIP Assay,Western Blot
Form	Purified
Gene Accession No.	O15379
Isotype	IgG2a
Includes	This ChIPAb+ HDAC3 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	HDAC3
Regulatory Status	RUO
Gene Symbols	HDAC3, SMAP45, HD3, RPD3, RPD3-2
Gene ID (Entrez)	NM_003883
Formulation	Anti-HDAC3 (mouse monoclonal). One vial containing 100μg of protein G purified monoclonal in buffer containing 0.02M phosphate buffer (pH 7.6), 0.25M NaCl, 0.1% sodium azide and 30% glycerol. Concentration: 1mg/mL. Normal Mouse IgG. One vial containing 125μg of purified mouse IgG in 125μL of storage buffer containing 0.1% sodium azide. ChIP Primers, p21. One vial containing 75μL of each primer (5μM) specific for a region of the human p21 (WAF1/CIP1/CDKN1A) promoter. FOR: CCC ACA GCA GAG GAG AAA GAA; REV: CTG GAA ATC TCT GCC CAG ACA
Immunogen	peptide (NEFYDGDHDNDKESDVEI) corresponding to amino acids 411-428 of human HDAC3
Classification	Monoclonal
Primary or Secondary	Primary