Antibody Panels and Kits
- (1)
- (1)
- (8)
- (24)
- (1)
- (3)
- (1)
- (11)
- (1)
- (3)
- (1)
- (1)
- (1)
- (2)
- (10)
- (2)
- (8)
- (2)
- (10)
- (2)
- (1)
- (7)
- (3)
- (2)
- (28)
- (2)
- (36)
- (34)
- (18)
- (1)
- (6)
- (1)
- (23)
- (13)
- (8)
- (1)
- (5)
- (3)
- (2)
- (6)
- (6)
- (1)
- (1)
- (1)
- (44)
- (7)
- (2)
- (7)
- (19)
- (6)
- (1)
- (1)
- (2)
- (10)
- (7)
- (1)
- (1)
- (4)
- (1)
- (2)
Filtered Search Results
MilliporeSigma™ RIPAb+™ SMN RIP Validated Antibody and Primer Set
This RIPAb+ SMN -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
MilliporeSigma™ RIPAb+™ HuR RIP Validated Antibody and Primer Set
This RIPAb+ HuR -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
MilliporeSigma™ RIPAb+™ PUM2 RIP Validated Antibody and Primer Set
Detect RIPAb+ PUM2 using this RIPAb+ PUM2 Antibody validated for use in ICC, IHC(P), Western Blotting, RNA Binding Protein Immunoprecipitation (RIP).
MilliporeSigma™ RIPAb+™ EF1α RIP Validated Antibody and Primer Set
This RIPAb+ EF1α -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
MilliporeSigma™ RIPAb+™ FXR1 RIP Validated Antibody and Primer Set
This RIPAb+ FXR1 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Invitrogen™ ELISA TMB Stabilized Chromogen
For use with all sandwich ELISAs which utilize Horseradish Peroxidase (HRP) as detecting enzyme
| Content And Storage | -20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles |
|---|---|
| Host Species | Rabbit |
| Applications | ChIP Assay,Dot Blot,Functional Assay,Western Blot |
| Form | Purified |
| Gene Accession No. | Q16695 |
| Isotype | IgG |
| Includes | This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers. |
| Antigen | Trimethyl-Histone H3 (Lys36)α |
| Regulatory Status | RUO |
| Gene Symbols | H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945 |
| Purification Method | Protein A purified |
| Gene ID (Entrez) | NP_003484 |
| Formulation | Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT |
| Immunogen | KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36). |
| Classification | Monoclonal |
| Primary or Secondary | Primary |
| Test Specificity | Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa. |
| Content And Storage | −20°C for one year |
|---|---|
| Host Species | Rabbit |
| Applications | ChIP Assay,Western Blot |
| Form | Purified |
| Gene Accession No. | Q16695 |
| Includes | Trimethyl-Histone H3 (Lys27) ChIP validated Antibody and Primer set including the ChIP-grade antibody and the specific control PCR primers used for chromatin immunoprecipitation of H3K27Me3. |
| Antigen | Trimethyl-Histone H3 (Lys27) |
| Regulatory Status | RUO |
| Gene Symbols | H3F3A, MGC87783, H3.3A, MGC87782, H3F3, H3.3B, H3F3B |
| Gene ID (Entrez) | NP_003484 |
| Formulation | Anti-trimethyl-Histone H3 (Lys27) (rabbit polyclonal IgG). One vial containing 100μg protein A purified IgG in 100μL buffer containing 0.1 M Tris-Glycine, pH 7.4, 0.15M NaCl with 0.05% sodium azide. Normal Rabbit IgG. One vial containing 125μg purified Rabbit IgG in 125μL storage buffer containing 0.1% sodium azide. ChIP Primers human alpha-Satellite. One vial containing 75μL of 5μM of each control primer specific for human alpha-Satellite. FOR: CTG CAC TAC CTG AAG AGG AC; REV: GAT GGT TCA ACA CTC TTA CA |
| Immunogen | KLH-conjugated,synthetic 2X-branched peptide containing the sequence ...AR(me3K)SAP... in which me3K corresponds to trimethyl-lysine at residue 27 of human Histone H3. |
| Classification | Polyclonal |
| Primary or Secondary | Primary |
| Test Specificity | trimethyl-Histone H3 (Lys27) |
MilliporeSigma™ RIPAb+™ STAU1 (Staufen 1) RIP Validated Antibody and Primer Set
This RIPAb+ STAU1 (Staufen 1) -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
MilliporeSigma™ RIPAb+™ EED RIP Validated Antibody and Primer Set
This RIPAb+ EED -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
MilliporeSigma™ RIPAb+™ pan Ago RIP Validated Antibody and Primer Set
This RIPAb+ pan Ago -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.