Panels et trousses d’anticorps
- (1)
- (1)
- (17)
- (8)
- (24)
- (1)
- (3)
- (1)
- (1)
- (11)
- (1)
- (3)
- (1)
- (1)
- (1)
- (2)
- (10)
- (2)
- (8)
- (19)
- (25)
- (2)
- (1)
- (22)
- (15)
- (3)
- (16)
- (28)
- (2)
- (47)
- (51)
- (18)
- (1)
- (6)
- (1)
- (5)
- (35)
- (13)
- (8)
- (1)
- (5)
- (3)
- (2)
- (6)
- (6)
- (1)
- (1)
- (1)
- (60)
- (7)
- (2)
- (7)
- (20)
- (6)
- (1)
- (1)
- (2)
- (10)
- (7)
- (1)
- (1)
- (1)
- (4)
- (1)
- (2)
Résultats de la recherche filtrée
Invitrogen™ ELISA TMB Stabilized Chromogen
For use with all sandwich ELISAs which utilize Horseradish Peroxidase (HRP) as detecting enzyme
MilliporeSigma™ Upstate ChIPAb+ REST - ChIP Validated Antibody and Primer Set
REST purified antibody against GST fusion protein corresponding to amino acids 801-1097 of human REST
| Alias du gène | CED, DPD1, LAP, TGFB, TGFbeta |
|---|---|
| À utiliser avec (équipement) | Colorimetric Microplate Reader |
| Type de produit | ELISA Kit |
| ID du gène (Entrez) | 7040 |
| Espèces cibles | Human |
| Applications | ChIP Assay,Western Blot |
|---|---|
| Numéro d’acquisition du gène | Q16695 |
| Symboles de gène | H3F3A, MGC87783, H3.3A, MGC87782, H3F3, H3.3B, H3F3B |
| Statut réglementaire | RUO |
| Primaire ou secondaire | Primary |
| Contenu et stockage | −20°C for one year |
| Forme | Purified |
| Immunogène | KLH-conjugated,synthetic 2X-branched peptide containing the sequence ...AR(me3K)SAP... in which me3K corresponds to trimethyl-lysine at residue 27 of human Histone H3. |
| Spécifications de test | trimethyl-Histone H3 (Lys27) |
| Classification | Polyclonal |
| Comprend | Trimethyl-Histone H3 (Lys27) ChIP validated Antibody and Primer set including the ChIP-grade antibody and the specific control PCR primers used for chromatin immunoprecipitation of H3K27Me3. |
| ID du gène (Entrez) | NP_003484 |
| Espèces hôtes | Rabbit |
| Formule | Anti-trimethyl-Histone H3 (Lys27) (rabbit polyclonal IgG). One vial containing 100μg protein A purified IgG in 100μL buffer containing 0.1 M Tris-Glycine, pH 7.4, 0.15M NaCl with 0.05% sodium azide. Normal Rabbit IgG. One vial containing 125μg purified Rabbit IgG in 125μL storage buffer containing 0.1% sodium azide. ChIP Primers human alpha-Satellite. One vial containing 75μL of 5μM of each control primer specific for human alpha-Satellite. FOR: CTG CAC TAC CTG AAG AGG AC; REV: GAT GGT TCA ACA CTC TTA CA |
| Antigène | Trimethyl-Histone H3 (Lys27) |
MilliporeSigma™ RIPAb+™ Fragile X Mental Retardation RIP Validated Antibody and Primer Set
This RIPAb+ Fragile X Mental Retardation Protein -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
MilliporeSigma™ RIPAb+™ hnRNPA1 (M9 Region) RIP Validated Antibody and Primer Set
This RIPAb+ hnRNPA1 (M9 Region) -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
MilliporeSigma™ RIPAb+™ SUZ12 RIP Validated Antibody and Primer Set
This RIPAb+ SUZ12 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
MilliporeSigma™ RIPAb+™ PABPC1 RIP Validated Antibody and Primer Set
This RIPAb+ PABPC1 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Invitrogen™ Click-iT™ Plus EdU Alexa Fluor™ 594 Flow Cytometry Assay Kit
Click-iT Plus EdU Alexa Fluor 594 Flow Cytometry Assay Kit
MilliporeSigma™ RIPAb+™ CUGBP2 RIP Validated Antibody and Primer Set
This RIPAb+ CUGBP2 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
| Applications | ChIP Assay,Dot Blot,Functional Assay,Western Blot |
|---|---|
| Numéro d’acquisition du gène | Q16695 |
| Symboles de gène | H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945 |
| Isotype | IgG |
| Statut réglementaire | RUO |
| Primaire ou secondaire | Primary |
| Contenu et stockage | -20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles |
| Forme | Purified |
| Immunogène | KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36). |
| Spécifications de test | Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa. |
| Classification | Monoclonal |
| Comprend | This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers. |
| Méthode de purification | Protein A purified |
| ID du gène (Entrez) | NP_003484 |
| Espèces hôtes | Rabbit |
| Formule | Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT |
| Antigène | Trimethyl-Histone H3 (Lys36)α |