accessibility menu, dialog, popup

UserName

Antibody Panels and Kits

Combinations of antibody-related products that may include sets of antibodies in pairs and cocktails, control particles, buffers, and other kits and panels; for use in specific applications such as immunoassays and T-cell activation.
Quantity 
  • (1)
  • (1)
  • (8)
  • (24)
  • (1)
  • (3)
  • (1)
  • (11)
Applications 
  • (10)
  • (2)
  • (8)
  • (2)
  • (10)
  • (2)
  • (1)
  • (7)
Classification 
  • (34)
  • (18)
Host Species 
  • (1)
  • (6)
  • (1)
  • (23)
  • (13)
  • (8)
Target Species 
  • (1)
  • (5)
  • (3)
  • (2)
  • (6)
  • (6)
  • (1)
  • (1)

Filtered Search Results

Products from some of our suppliers do not display in filtered search results. Please clear all filters to see these products.

Narrow Results

Narrow Results

category

brands

  • (15)
  • (37)
  • (7)
  • (16)

Quantity

  • (1)
  • (1)
  • (8)
  • (24)
  • (1)
  • (3)
  • (1)
Show all

Applications

  • (10)
  • (2)
  • (8)
  • (2)
  • (10)
  • (2)
  • (1)
Show all

Classification

  • (34)
  • (18)

Host Species

  • (1)
  • (6)
  • (1)
  • (23)
  • (13)
  • (8)

Target Species

  • (1)
  • (5)
  • (3)
  • (2)
  • (6)
  • (6)
  • (1)
Show all

Form

  • (2)
  • (1)
  • (1)
  • (7)
  • (28)
  • (2)

Isotype

  • (5)
  • (3)
  • (8)
  • (2)
  • (12)
  • (1)
  • (3)

Conjugate

  • (3)
  • (1)
  • (3)
  • (2)
  • (1)
  • (5)
  • (3)
Show all

Regulatory Status

  • (29)
Keyword Search:
1 – 15 of 59 results
1

MilliporeSigma™ RIPAb+™ Ago3 RIP Validated Antibody and Primer Set

This RIPAb+ Ago3 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

3

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys36)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Content And Storage -20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species Rabbit
Applications ChIP Assay,Dot Blot,Functional Assay,Western Blot
Form Purified
Gene Accession No. Q16695
Isotype IgG
Includes This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen Trimethyl-Histone H3 (Lys36)α
Regulatory Status RUO
Gene Symbols H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Purification Method Protein A purified
Gene ID (Entrez) NP_003484
Formulation Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT
Immunogen KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36).
Classification Monoclonal
Primary or Secondary Primary
Test Specificity Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa.
4

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys4)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Content And Storage −20°C for one year from date of shipment
Host Species Rabbit
Applications ChIP Assay,ChIP sequencing (ChIP-seq),Western Blot
Form Purified
Gene Accession No. Q66I33
Isotype IgG
Includes Trimethyl-Histone H3 (Lys4) ChIP validated Antibody and Primer set including the ChIP-grade antibody and the specific control PCR primers used for chromatin immunoprecipitation of H3K4Me3.
Antigen Trimethyl-Histone H3 (Lys4)α
Regulatory Status RUO
Gene Symbols H3F3A, H3F3B, H3F3
Gene ID (Entrez) NM_003493
Formulation Anti-Trimethyl-Histone H3 (Lys4) recombin-ant rabbit monoclonal IgG. One vial containing 75μL of protein A purified rabbit IgG in storage buffer (0.1M Tris-Glycine pH 7.4, 0.15M NaCl, 0.05% NaN3, with the addition of 40% glycerol.
Normal Rabbit IgG. One vial containing 75μL of normal rabbit IgG.
Control Primers. One vial containing 75μL of 5μM of each primer specific for human GAPDH. FOR: TAC TAG CGG TTT TAC GGG CG REV: TCG AAC AGG AGG AGC AGA GAG CGA
Immunogen The trimethyl-histone H3 (Lys4) antibody is made against a BSA-conjugated,synthetic peptide containing the sequence …RT[me3K]QT… in which me3K corresponds to trimethyl-lysine 4 of human histone H3
Classification Monoclonal
Primary or Secondary Primary
Test Specificity Trimethyl-Histone H3 (Lys4)
5

MilliporeSigma™ Upstate™ HDAC3 Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Content And Storage -20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species Mouse
Applications ChIP Assay,Western Blot
Form Purified
Gene Accession No. O15379
Isotype IgG2a
Includes This ChIPAb+ HDAC3 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen HDAC3
Regulatory Status RUO
Gene Symbols HDAC3, SMAP45, HD3, RPD3, RPD3-2
Gene ID (Entrez) NM_003883
Formulation Anti-HDAC3 (mouse monoclonal). One vial containing 100μg of protein G purified monoclonal in buffer containing 0.02M phosphate buffer (pH 7.6), 0.25M NaCl, 0.1% sodium azide and 30% glycerol. Concentration: 1mg/mL. Normal Mouse IgG. One vial containing 125μg of purified mouse IgG in 125μL of storage buffer containing 0.1% sodium azide. ChIP Primers, p21. One vial containing 75μL of each primer (5μM) specific for a region of the human p21 (WAF1/CIP1/CDKN1A) promoter. FOR: CCC ACA GCA GAG GAG AAA GAA; REV: CTG GAA ATC TCT GCC CAG ACA
Immunogen peptide (NEFYDGDHDNDKESDVEI) corresponding to amino acids 411-428 of human HDAC3
Classification Monoclonal
Primary or Secondary Primary
6

MilliporeSigma™ RIPAb+™ SUZ12 RIP Validated Antibody and Primer Set

This RIPAb+ SUZ12 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

7

MilliporeSigma™ RIPAb+™ HuR RIP Validated Antibody and Primer Set

This RIPAb+ HuR -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

8

MilliporeSigma™ RIPAb+™ Ago2 RIP Validated Antibody and Primer Set

This RIPAb+ Ago2 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

9

MilliporeSigma™ RIPAb+™ AUF1 RIP Validated Antibody and Primer Set

This RIPAb+ AUF1 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

10

MilliporeSigma™ Upstate™ Monomethyl-Histone H4 (Lys20), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Content And Storage -20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species Rabbit
Applications ChIP Assay,Western Blot
Gene Accession No. P62805
Includes This ChIPAb+ Monomethyl-Histone H4 (Lys20) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen Monomethyl-Histone H4 (Lys20)
Regulatory Status RUO
Gene Symbols H4/A , H4/B, H4/C , H4/D, H4/E, H4/G, H4/H, H4/I, H4/J, H4/J, H4/M, H4/N, H4/O , H4/a , H4F2, H4FA , H4FB , H4FC , H4FD, H4FE, H4FG, H4FH, H4FI , H4FJ, H4FK, H4FM , H4FN, H4FO, HIST2H4
Purification Method Affinity Purified
Gene ID (Entrez) NM_003538.3
Formulation Anti-monomethyl-Histone H4 (Lys20) (rabbit polyclonal IgG). One vial containing 100μg of affinity purified antibody in 100μL 0.1M Tris-Glycine (pH 7.4), 15mM NaCl, and 0.05% NaN3. Normal Rabbit IgG. One vial containing 125μg of purified rabbit IgG in 125μL storage buffer. ChIP Primers GAPDH Coding Region. One vial containing 75μL of 5μM of each primer specific for human GAPDH coding region. FOR: GGC TCC CAC CTT TCT CAT CC; REV: GGC CAT CCA CAG TCT TCT GG
Immunogen The immunogen was a synthetic peptide corresponding to amino acids 15-24 of histone H4,monomethylated on Lys20.
Classification Polyclonal
Primary or Secondary Primary
Test Specificity Recognizes histone H4, Mr ∽11kDa.
11

MilliporeSigma™ Upstate™ EEDα, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Content And Storage -20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species Mouse
Applications ChIP Assay,Western Blot
Form Purified
Gene Accession No. O75530
Isotype IgG2a κ
Includes This ChIPAb+ EED -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen EEDα
Regulatory Status RUO
Gene Symbols EED; WAIT-1
Gene ID (Entrez) NP_003788
Formulation Anti-EED (Mouse monoclonal IgG). One vial containing 50μg of protein G purified antibody in 0.1 M Tris-Glycine (pH 7.4) 150mM NaCl, containing 0.05% azide. May contain 30% glycerol (see certificate of analysis for details). Normal mouse IgG. Two vials containing 25μg of purified mouse IgG in 25μL of storage buffer containing 0.1% sodium azide. ChIP Primers, HoxA2 upstream. One vial containing 75μL of 5μM of each primer specific for the promoter region of human HoxA2. FOR: AGG AAA GAT TTT GGT TGG GAA G; REV: AAA AAG AGG GAA AGG GAC AGA C
Immunogen Recombinant fusion protein of full length murine EED tagged with MBP.
Classification Monoclonal
Primary or Secondary Primary
Test Specificity Recognizes EED, MW: ∽50kDa.
12

MilliporeSigma™ Upstate™ Acetyl-Histone H4 (Lys8), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Content And Storage -20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species Rabbit
Applications ChIP Assay,Immunoprecipitation,Western Blot
Form Serum
Gene Accession No. P62805
Includes The ChIPAb+ Acetyl-Histone H4 (Lys8) set includes the Acetyl-Histone H4 (Lys8) antibody, a negative control rabbit serum and qPCR primers which amplify a 134bp region of human HSPCA.
Antigen Acetyl-Histone H4 (Lys8)
Regulatory Status RUO
Gene Symbols HIST1H4A, H4/J, HIST1H4F, HIST1H4L, H4FN, H4FA, H4FH, HIST1H4H, H4F2, H4FM, H4/A, H4FK, H4FG, HIST2H4, H4FB, H4/K, HIST1H4I, H4/N, HIST1H4B, H4FE, H4/M, H4/a, HIST1H4E, HIST4H4, HIST2H4A, H4FC, H4FI, H4/H, HIST1H4C, H4/G, HIST1H4K, H4FJ, H4FD, H4/I, H4/B, H4/D, H4/C, HIST1H4J, HIST1H4D, H4/E
Purification Method Unpurified
Gene ID (Entrez) NM_175054
Formulation Anti-Acetyl-Histone H4 (Lys8) (rabbit polyclonal). One vial containing 50μL of antiserum containing 0.05% sodium azide. Normal Rabbit Serum. One vial containing 100μL of antiserum containing 0.05% sodium azide. ChIP Primers, HSPCA. One vial containing 75μL of 5μM of each primer specific for human HSPCA. FOR: GCA ACA GCT ACC ACA GGA CCA; REV: GAG CGT GTG AAA TCA ACA TAA AGC
Immunogen Synthetic peptide corresponding to yeast Histone H4 acetylated at lysine 8.
Classification Polyclonal
Primary or Secondary Primary
Test Specificity Recognizes acetyl-Histone H4 (Lys8).
13

MilliporeSigma™ RIPAb+™ hnRNPA1 (M9 Region) RIP Validated Antibody and Primer Set

This RIPAb+ hnRNPA1 (M9 Region) -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

14

MilliporeSigma™ RIPAb+™ Upf1 RIP Validated Antibody and Primer Set

This RIPAb+ Upf1 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

15

MilliporeSigma™ RIPAb+™ hnRNPA1 RIP Validated Antibody and Primer Set

This RIPAb+ hnRNPA1 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.