Panels et trousses d’anticorps

Combinaisons de produits liés aux anticorps qui peuvent comprendre des séries d’anticorps par paires et en mélanges, des particules de contrôle, des tampons et d’autres trousses et bilans; à utiliser dans des applications spécifiques comme les tests immunologiques et l’activation des lymphocytes T.

Rechercher dans les résultats

1 – 15 de 59 résultats

MilliporeSigma™ RIPAb+™ Ago1 RIP Validated Antibody and Primer Set

This RIPAb+ Ago1 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

Prix et disponibilité

Anti-Human Foxp3 Staining Set APC, eBioscience™

Antibody Staining Kit

Prix et disponibilité

Anti-Human Foxp3 Staining Set APC, eBioscience™

Antibody Staining Kit

Prix et disponibilité

MilliporeSigma™ RIPAb+™ SUZ12 RIP Validated Antibody and Primer Set

This RIPAb+ SUZ12 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

Prix et disponibilité

MilliporeSigma™ Upstate™ E2F-1α, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Prix et disponibilité
Spécifications

Applications	ChIP Assay,ChIP sequencing (ChIP-seq),Immunoprecipitation
Numéro d’acquisition du gène	Q01094
Symboles de gène	E2F1, RBAP-1, E2F-1, RBP3, RBBP3, RBBP-3, PBR3
Isotype	IgG
Statut réglementaire	RUO
Primaire ou secondaire	Primary
Contenu et stockage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Forme	Purified
Immunogène	GST fusion protein corresponding to full-length human E2F-1.
Spécifications de test	The epitopes have been mapped to amino acids 1 to 89 and to amino acids 342 to 386.
Classification	Monoclonal
Comprend	This ChIPAb+ E2F-1 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Méthode de purification	Protein G purified
ID du gène (Entrez)	NP_005216
Espèces hôtes	Mouse
Formule	Anti-E2F-1 (mouse monoclonal). One vial containing 25μg of protein G purified monoclonal mixed IgG in 25μL of buffer containing 0.1 M Tris-glycine, pH 7.4, 0.15 M NaCl with 0.05% sodium azide. Frozen solution. Nornal Mouse IgG. One vial containing 25μg of purified IgG in 25μL of storage buffer containing 0.1% sodium azide. ChIP Primers, CDC2 promoter. One vial containing 75μL of 5μM each primer specific for human CDC2 promoter. FOR: CGC CCT TTC CTC TTT CTT TC; REV: ATC GGG TAG CCC GTA GAC TT
Antigène	E2F-1α

MilliporeSigma™ Upstate™ HDAC3 Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Prix et disponibilité
Spécifications

Applications	ChIP Assay,Western Blot
Numéro d’acquisition du gène	O15379
Symboles de gène	HDAC3, SMAP45, HD3, RPD3, RPD3-2
Isotype	IgG2a
Statut réglementaire	RUO
Primaire ou secondaire	Primary
Contenu et stockage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Forme	Purified
Immunogène	peptide (NEFYDGDHDNDKESDVEI) corresponding to amino acids 411-428 of human HDAC3
Classification	Monoclonal
Comprend	This ChIPAb+ HDAC3 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
ID du gène (Entrez)	NM_003883
Espèces hôtes	Mouse
Formule	Anti-HDAC3 (mouse monoclonal). One vial containing 100μg of protein G purified monoclonal in buffer containing 0.02M phosphate buffer (pH 7.6), 0.25M NaCl, 0.1% sodium azide and 30% glycerol. Concentration: 1mg/mL. Normal Mouse IgG. One vial containing 125μg of purified mouse IgG in 125μL of storage buffer containing 0.1% sodium azide. ChIP Primers, p21. One vial containing 75μL of each primer (5μM) specific for a region of the human p21 (WAF1/CIP1/CDKN1A) promoter. FOR: CCC ACA GCA GAG GAG AAA GAA; REV: CTG GAA ATC TCT GCC CAG ACA
Antigène	HDAC3

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys27), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Prix et disponibilité
Spécifications

Applications	ChIP Assay,Western Blot
Numéro d’acquisition du gène	Q16695
Symboles de gène	H3F3A, MGC87783, H3.3A, MGC87782, H3F3, H3.3B, H3F3B
Statut réglementaire	RUO
Primaire ou secondaire	Primary
Contenu et stockage	−20°C for one year
Forme	Purified
Immunogène	KLH-conjugated,synthetic 2X-branched peptide containing the sequence ...AR(me3K)SAP... in which me3K corresponds to trimethyl-lysine at residue 27 of human Histone H3.
Spécifications de test	trimethyl-Histone H3 (Lys27)
Classification	Polyclonal
Comprend	Trimethyl-Histone H3 (Lys27) ChIP validated Antibody and Primer set including the ChIP-grade antibody and the specific control PCR primers used for chromatin immunoprecipitation of H3K27Me3.
ID du gène (Entrez)	NP_003484
Espèces hôtes	Rabbit
Formule	Anti-trimethyl-Histone H3 (Lys27) (rabbit polyclonal IgG). One vial containing 100μg protein A purified IgG in 100μL buffer containing 0.1 M Tris-Glycine, pH 7.4, 0.15M NaCl with 0.05% sodium azide. Normal Rabbit IgG. One vial containing 125μg purified Rabbit IgG in 125μL storage buffer containing 0.1% sodium azide. ChIP Primers human alpha-Satellite. One vial containing 75μL of 5μM of each control primer specific for human alpha-Satellite. FOR: CTG CAC TAC CTG AAG AGG AC; REV: GAT GGT TCA ACA CTC TTA CA
Antigène	Trimethyl-Histone H3 (Lys27)

Invitrogen™ ELISA Assay Buffer (5X)

For use with antibody pairs (ELISA)

Prix et disponibilité

Invitrogen™ TGF beta Human Matched Antibody Pair

Matched Antibody Pair

Prix et disponibilité

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys36)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Prix et disponibilité
Spécifications

Applications	ChIP Assay,Dot Blot,Functional Assay,Western Blot
Numéro d’acquisition du gène	Q16695
Symboles de gène	H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Isotype	IgG
Statut réglementaire	RUO
Primaire ou secondaire	Primary
Contenu et stockage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Forme	Purified
Immunogène	KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36).
Spécifications de test	Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa.
Classification	Monoclonal
Comprend	This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Méthode de purification	Protein A purified
ID du gène (Entrez)	NP_003484
Espèces hôtes	Rabbit
Formule	Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT
Antigène	Trimethyl-Histone H3 (Lys36)α

MilliporeSigma™ Upstate™ Acetyl-Histone H4 (Lys5)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Prix et disponibilité
Spécifications

Applications	ChIP Assay,Immunoprecipitation,Western Blot
Numéro d’acquisition du gène	P62805
Symboles de gène	HIST1H4A, H4/J, HIST1H4F, HIST1H4L, H4FN, H4FA, H4FH, HIST1H4H, H4F2, H4FM, H4/A, H4FK, H4FG, HIST2H4, H4FB, H4/K, HIST1H4I, H4/N, HIST1H4B, H4FE, H4/M, H4/a, HIST1H4E, HIST4H4, HIST2H4A, H4FC, H4FI, H4/H, HIST1H4C, H4/G, HIST1H4K, H4FJ, H4FD, H4/I, H4/B, H4/D, H4/C, HIST1H4J, HIST1H4D, H4/E
Isotype	IgG
Statut réglementaire	RUO
Primaire ou secondaire	Primary
Contenu et stockage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Forme	Culture Supernatant
Immunogène	Peptide corresponding to Histone H4 containing the sequence [GRG-AcK-GGK] on which Lys5 is acetylated.
Spécifications de test	Recognizes Histone H4 acetylated on Lys5.
Classification	Monoclonal
Comprend	This ChIPAb+ Acetyl-Histone H4 (Lys5) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
ID du gène (Entrez)	NP_001029249
Espèces hôtes	Rabbit
Formule	Anti-Acetyl-Histone H4 (Lys5) (rabbit monoclonal IgG). One vial containing 50μL of rabbit monoclonal IgG cell culture supernatant in 0.1% sodium azide. Negative Control Supernatant (rabbit). One vial containing 50μL of cultured supernatant in 0.05% sodium azide. Control Primers. One vial containing 75μL of 5μM each primer specific for the human GAPDH promoter. FOR: TAC TAG CGG TTT TAC GGG CG; REV: TCG AAC AGG AGG AGC AGA GAG CGA
Antigène	Acetyl-Histone H4 (Lys5)α

MilliporeSigma™ RIPAb+™ SMN RIP Validated Antibody and Primer Set

This RIPAb+ SMN -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

Prix et disponibilité

MilliporeSigma™ Upstate™ Androgen Receptor- ChIP Validated, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Prix et disponibilité
Spécifications

Applications	ChIP Assay,Immunohistochemistry,Immunoprecipitation,Western Blot
Numéro d’acquisition du gène	P10275
Symboles de gène	AR, DHTR, SMAX1, HUMARA, KD, SBMA, TFM, OTTHUMP00000061928, AIS, NR3C4
Statut réglementaire	RUO
Primaire ou secondaire	Primary
Contenu et stockage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Immunogène	Peptide corresponding to amino acids 1-21 of the Human Androgen Receptor (MEVQLGLGRVYPRPPSKTYRG)
Spécifications de test	Recognizes Androgen Receptor. No cross-reactivity with estrogen, progesterone or glucocorticoid receptors.
Classification	Polyclonal
Comprend	ChIPAb+ Androgen Receptor set includes the Androgen Receptor antibody, a Normal Rabbit IgG, and control primers, which amplify a 85bp region of the human prostate specific antigen (PSA) enhancer region.
Méthode de purification	Affinity Purified
ID du gène (Entrez)	NP_000035
Espèces hôtes	Rabbit
Formule	Anti-Androgen Receptor (Rabbit Polyclonal). One vial containing 125μL (0.2μg/μL) purified rabbit polyclonal in buffer containing 0.1M Tris-Glycine (pH 7.4), 150mM NaCl, and 0.05% sodium azide, before the addition of 30% glycerol. Normal Rabbit IgG. One vial containing 125μg (1.0μg/μL) Rabbit IgG in 125μL storage buffer containing 0.05% sodium azide. ChIP Primers, PSA. One vial containing 75μL of 5μM of each primer specific for human prostate-specific antigen enhancer region. (chr19:51354179+51354263, hg19 build) FOR: 5’ GCC TGG ATC TGA GAG AGA TAT CAT C 3’; REV: 5’ ACA CCT TTT TTT TTC TGG ATT GTT G 3’
Antigène	Androgen Receptor- ChIP Validated

MilliporeSigma™ RIPAb+™ EF1α RIP Validated Antibody and Primer Set

This RIPAb+ EF1α -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

Prix et disponibilité

MilliporeSigma™ RIPAb+™ Fragile X Mental Retardation RIP Validated Antibody and Primer Set

This RIPAb+ Fragile X Mental Retardation Protein -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

Prix et disponibilité

Panels et trousses d’anticorps

Résultats de la recherche filtrée

Affiner les résultats