Antibody Panels and Kits

Combinations of antibody-related products that may include sets of antibodies in pairs and cocktails, control particles, buffers, and other kits and panels; for use in specific applications such as immunoassays and T-cell activation.

Search Within Results

1 – 15 of 59 results

MilliporeSigma™ RIPAb+™ Ago1 RIP Validated Antibody and Primer Set

This RIPAb+ Ago1 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

Pricing and Availability

Anti-Human Foxp3 Staining Set APC, eBioscience™

Antibody Staining Kit

Pricing and Availability

Anti-Human Foxp3 Staining Set APC, eBioscience™

Antibody Staining Kit

Pricing and Availability

MilliporeSigma™ RIPAb+™ SUZ12 RIP Validated Antibody and Primer Set

This RIPAb+ SUZ12 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

Pricing and Availability

MilliporeSigma™ Upstate™ E2F-1α, Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing and Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Mouse
Applications	ChIP Assay,ChIP sequencing (ChIP-seq),Immunoprecipitation
Form	Purified
Gene Accession No.	Q01094
Isotype	IgG
Includes	This ChIPAb+ E2F-1 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	E2F-1α
Regulatory Status	RUO
Gene Symbols	E2F1, RBAP-1, E2F-1, RBP3, RBBP3, RBBP-3, PBR3
Purification Method	Protein G purified
Gene ID (Entrez)	NP_005216
Formulation	Anti-E2F-1 (mouse monoclonal). One vial containing 25μg of protein G purified monoclonal mixed IgG in 25μL of buffer containing 0.1 M Tris-glycine, pH 7.4, 0.15 M NaCl with 0.05% sodium azide. Frozen solution. Nornal Mouse IgG. One vial containing 25μg of purified IgG in 25μL of storage buffer containing 0.1% sodium azide. ChIP Primers, CDC2 promoter. One vial containing 75μL of 5μM each primer specific for human CDC2 promoter. FOR: CGC CCT TTC CTC TTT CTT TC; REV: ATC GGG TAG CCC GTA GAC TT
Immunogen	GST fusion protein corresponding to full-length human E2F-1.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	The epitopes have been mapped to amino acids 1 to 89 and to amino acids 342 to 386.

MilliporeSigma™ Upstate™ HDAC3 Mouse monoclonal, ChIP Validated Antibody and Primer Set

Mouse Monoclonal Antibody

Pricing and Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Mouse
Applications	ChIP Assay,Western Blot
Form	Purified
Gene Accession No.	O15379
Isotype	IgG2a
Includes	This ChIPAb+ HDAC3 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	HDAC3
Regulatory Status	RUO
Gene Symbols	HDAC3, SMAP45, HD3, RPD3, RPD3-2
Gene ID (Entrez)	NM_003883
Formulation	Anti-HDAC3 (mouse monoclonal). One vial containing 100μg of protein G purified monoclonal in buffer containing 0.02M phosphate buffer (pH 7.6), 0.25M NaCl, 0.1% sodium azide and 30% glycerol. Concentration: 1mg/mL. Normal Mouse IgG. One vial containing 125μg of purified mouse IgG in 125μL of storage buffer containing 0.1% sodium azide. ChIP Primers, p21. One vial containing 75μL of each primer (5μM) specific for a region of the human p21 (WAF1/CIP1/CDKN1A) promoter. FOR: CCC ACA GCA GAG GAG AAA GAA; REV: CTG GAA ATC TCT GCC CAG ACA
Immunogen	peptide (NEFYDGDHDNDKESDVEI) corresponding to amino acids 411-428 of human HDAC3
Classification	Monoclonal
Primary or Secondary	Primary

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys27), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing and Availability
Specifications

Content And Storage	−20°C for one year
Host Species	Rabbit
Applications	ChIP Assay,Western Blot
Form	Purified
Gene Accession No.	Q16695
Includes	Trimethyl-Histone H3 (Lys27) ChIP validated Antibody and Primer set including the ChIP-grade antibody and the specific control PCR primers used for chromatin immunoprecipitation of H3K27Me3.
Antigen	Trimethyl-Histone H3 (Lys27)
Regulatory Status	RUO
Gene Symbols	H3F3A, MGC87783, H3.3A, MGC87782, H3F3, H3.3B, H3F3B
Gene ID (Entrez)	NP_003484
Formulation	Anti-trimethyl-Histone H3 (Lys27) (rabbit polyclonal IgG). One vial containing 100μg protein A purified IgG in 100μL buffer containing 0.1 M Tris-Glycine, pH 7.4, 0.15M NaCl with 0.05% sodium azide. Normal Rabbit IgG. One vial containing 125μg purified Rabbit IgG in 125μL storage buffer containing 0.1% sodium azide. ChIP Primers human alpha-Satellite. One vial containing 75μL of 5μM of each control primer specific for human alpha-Satellite. FOR: CTG CAC TAC CTG AAG AGG AC; REV: GAT GGT TCA ACA CTC TTA CA
Immunogen	KLH-conjugated,synthetic 2X-branched peptide containing the sequence ...AR(me3K)SAP... in which me3K corresponds to trimethyl-lysine at residue 27 of human Histone H3.
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	trimethyl-Histone H3 (Lys27)

Invitrogen™ ELISA Assay Buffer (5X)

For use with antibody pairs (ELISA)

Pricing and Availability

Invitrogen™ TGF beta Human Matched Antibody Pair

Matched Antibody Pair

Pricing and Availability

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys36)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Pricing and Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Dot Blot,Functional Assay,Western Blot
Form	Purified
Gene Accession No.	Q16695
Isotype	IgG
Includes	This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Trimethyl-Histone H3 (Lys36)α
Regulatory Status	RUO
Gene Symbols	H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Purification Method	Protein A purified
Gene ID (Entrez)	NP_003484
Formulation	Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT
Immunogen	KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36).
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa.

MilliporeSigma™ Upstate™ Acetyl-Histone H4 (Lys5)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Pricing and Availability
Specifications

Content And Storage	-20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Immunoprecipitation,Western Blot
Form	Culture Supernatant
Gene Accession No.	P62805
Isotype	IgG
Includes	This ChIPAb+ Acetyl-Histone H4 (Lys5) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen	Acetyl-Histone H4 (Lys5)α
Regulatory Status	RUO
Gene Symbols	HIST1H4A, H4/J, HIST1H4F, HIST1H4L, H4FN, H4FA, H4FH, HIST1H4H, H4F2, H4FM, H4/A, H4FK, H4FG, HIST2H4, H4FB, H4/K, HIST1H4I, H4/N, HIST1H4B, H4FE, H4/M, H4/a, HIST1H4E, HIST4H4, HIST2H4A, H4FC, H4FI, H4/H, HIST1H4C, H4/G, HIST1H4K, H4FJ, H4FD, H4/I, H4/B, H4/D, H4/C, HIST1H4J, HIST1H4D, H4/E
Gene ID (Entrez)	NP_001029249
Formulation	Anti-Acetyl-Histone H4 (Lys5) (rabbit monoclonal IgG). One vial containing 50μL of rabbit monoclonal IgG cell culture supernatant in 0.1% sodium azide. Negative Control Supernatant (rabbit). One vial containing 50μL of cultured supernatant in 0.05% sodium azide. Control Primers. One vial containing 75μL of 5μM each primer specific for the human GAPDH promoter. FOR: TAC TAG CGG TTT TAC GGG CG; REV: TCG AAC AGG AGG AGC AGA GAG CGA
Immunogen	Peptide corresponding to Histone H4 containing the sequence [GRG-AcK-GGK] on which Lys5 is acetylated.
Classification	Monoclonal
Primary or Secondary	Primary
Test Specificity	Recognizes Histone H4 acetylated on Lys5.

MilliporeSigma™ RIPAb+™ SMN RIP Validated Antibody and Primer Set

This RIPAb+ SMN -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

Pricing and Availability

MilliporeSigma™ Upstate™ Androgen Receptor- ChIP Validated, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Pricing and Availability
Specifications

Content And Storage	-20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species	Rabbit
Applications	ChIP Assay,Immunohistochemistry,Immunoprecipitation,Western Blot
Gene Accession No.	P10275
Includes	ChIPAb+ Androgen Receptor set includes the Androgen Receptor antibody, a Normal Rabbit IgG, and control primers, which amplify a 85bp region of the human prostate specific antigen (PSA) enhancer region.
Antigen	Androgen Receptor- ChIP Validated
Regulatory Status	RUO
Gene Symbols	AR, DHTR, SMAX1, HUMARA, KD, SBMA, TFM, OTTHUMP00000061928, AIS, NR3C4
Purification Method	Affinity Purified
Gene ID (Entrez)	NP_000035
Formulation	Anti-Androgen Receptor (Rabbit Polyclonal). One vial containing 125μL (0.2μg/μL) purified rabbit polyclonal in buffer containing 0.1M Tris-Glycine (pH 7.4), 150mM NaCl, and 0.05% sodium azide, before the addition of 30% glycerol. Normal Rabbit IgG. One vial containing 125μg (1.0μg/μL) Rabbit IgG in 125μL storage buffer containing 0.05% sodium azide. ChIP Primers, PSA. One vial containing 75μL of 5μM of each primer specific for human prostate-specific antigen enhancer region. (chr19:51354179+51354263, hg19 build) FOR: 5’ GCC TGG ATC TGA GAG AGA TAT CAT C 3’; REV: 5’ ACA CCT TTT TTT TTC TGG ATT GTT G 3’
Immunogen	Peptide corresponding to amino acids 1-21 of the Human Androgen Receptor (MEVQLGLGRVYPRPPSKTYRG)
Classification	Polyclonal
Primary or Secondary	Primary
Test Specificity	Recognizes Androgen Receptor. No cross-reactivity with estrogen, progesterone or glucocorticoid receptors.

MilliporeSigma™ RIPAb+™ EF1α RIP Validated Antibody and Primer Set

This RIPAb+ EF1α -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

Pricing and Availability

MilliporeSigma™ RIPAb+™ Fragile X Mental Retardation RIP Validated Antibody and Primer Set

This RIPAb+ Fragile X Mental Retardation Protein -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

Pricing and Availability

Antibody Panels and Kits

Filtered Search Results

Narrow Results