accessibility menu, dialog, popup

UserName

Antibody Panels and Kits

Combinations of antibody-related products that may include sets of antibodies in pairs and cocktails, control particles, buffers, and other kits and panels; for use in specific applications such as immunoassays and T-cell activation.
Quantity 
  • (1)
  • (1)
  • (8)
  • (24)
  • (1)
  • (3)
  • (1)
  • (11)
  • (1)
  • (3)
  • (1)
  • (1)
  • (1)
  • (2)
Applications 
  • (10)
  • (2)
  • (8)
  • (2)
  • (10)
  • (2)
  • (1)
  • (7)
  • (3)
  • (2)
  • (28)
  • (2)
  • (36)
Classification 
  • (34)
  • (18)
Host Species 
  • (1)
  • (6)
  • (1)
  • (23)
  • (13)
  • (8)
Target Species 
  • (1)
  • (5)
  • (3)
  • (2)
  • (6)
  • (6)
  • (1)
  • (1)
  • (1)
  • (44)
  • (7)
  • (2)
  • (7)
  • (19)
  • (6)
  • (1)
  • (1)
  • (2)
  • (10)
  • (7)
  • (1)
  • (1)
  • (4)
  • (1)
  • (2)

Filtered Search Results

Products from some of our suppliers do not display in filtered search results. Please clear all filters to see these products.

Narrow Results

Narrow Results

category

brands

  • (16)
  • (37)
  • (7)

Quantity

  • (1)
  • (1)
  • (8)
  • (24)
  • (1)
  • (3)
  • (1)
  • (11)
  • (1)
  • (3)
  • (1)
  • (1)
  • (1)
  • (2)

Applications

  • (10)
  • (2)
  • (8)
  • (2)
  • (10)
  • (2)
  • (1)
  • (7)
  • (3)
  • (2)
  • (28)
  • (2)
  • (36)

Classification

  • (34)
  • (18)

Host Species

  • (1)
  • (6)
  • (1)
  • (23)
  • (13)
  • (8)

Target Species

  • (1)
  • (5)
  • (3)
  • (2)
  • (6)
  • (6)
  • (1)
  • (1)
  • (1)
  • (44)
  • (7)
  • (2)
  • (7)
  • (19)
  • (6)
  • (1)
  • (1)
  • (2)
  • (10)
  • (7)
  • (1)
  • (1)
  • (4)
  • (1)
  • (2)

Form

  • (2)
  • (1)
  • (1)
  • (7)
  • (28)
  • (2)

Isotype

  • (5)
  • (3)
  • (8)
  • (2)
  • (12)
  • (1)
  • (3)

Conjugate

  • (3)
  • (1)
  • (3)
  • (2)
  • (1)
  • (5)
  • (3)
  • (11)

Regulatory Status

  • (29)

Search Within Results
Keyword Search:
1 – 15 of 59 results
1

MilliporeSigma™ Upstate ChIPAb+ REST - ChIP Validated Antibody and Primer Set

REST purified antibody against GST fusion protein corresponding to amino acids 801-1097 of human REST

2

MilliporeSigma™ Upstate™ Monomethyl-Histone H4 (Lys20), Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Content And Storage -20°C for up to 12 months from date of receipt; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species Rabbit
Applications ChIP Assay,Western Blot
Gene Accession No. P62805
Includes This ChIPAb+ Monomethyl-Histone H4 (Lys20) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen Monomethyl-Histone H4 (Lys20)
Regulatory Status RUO
Gene Symbols H4/A , H4/B, H4/C , H4/D, H4/E, H4/G, H4/H, H4/I, H4/J, H4/J, H4/M, H4/N, H4/O , H4/a , H4F2, H4FA , H4FB , H4FC , H4FD, H4FE, H4FG, H4FH, H4FI , H4FJ, H4FK, H4FM , H4FN, H4FO, HIST2H4
Purification Method Affinity Purified
Gene ID (Entrez) NM_003538.3
Formulation Anti-monomethyl-Histone H4 (Lys20) (rabbit polyclonal IgG). One vial containing 100μg of affinity purified antibody in 100μL 0.1M Tris-Glycine (pH 7.4), 15mM NaCl, and 0.05% NaN3. Normal Rabbit IgG. One vial containing 125μg of purified rabbit IgG in 125μL storage buffer. ChIP Primers GAPDH Coding Region. One vial containing 75μL of 5μM of each primer specific for human GAPDH coding region. FOR: GGC TCC CAC CTT TCT CAT CC; REV: GGC CAT CCA CAG TCT TCT GG
Immunogen The immunogen was a synthetic peptide corresponding to amino acids 15-24 of histone H4,monomethylated on Lys20.
Classification Polyclonal
Primary or Secondary Primary
Test Specificity Recognizes histone H4, Mr ∽11kDa.
3

MilliporeSigma™ RIPAb+™ Ago3 RIP Validated Antibody and Primer Set

This RIPAb+ Ago3 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

4

MilliporeSigma™ RIPAb+™ AUF1 RIP Validated Antibody and Primer Set

This RIPAb+ AUF1 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

7

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys36)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Content And Storage -20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species Rabbit
Applications ChIP Assay,Dot Blot,Functional Assay,Western Blot
Form Purified
Gene Accession No. Q16695
Isotype IgG
Includes This ChIPAb+ Trimethyl-Histone H3 (Lys36) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen Trimethyl-Histone H3 (Lys36)α
Regulatory Status RUO
Gene Symbols H3.4, H3/g, H3/t, H3FT, H3T, H3t, MGC126886, MGC126888, OTTHUMP00000037945
Purification Method Protein A purified
Gene ID (Entrez) NP_003484
Formulation Anti-Trimethyl-Histone H3 (Lys36) (rabbit monoclonal IgG). One vial containing 50μL of protein A purified IgG in a solution containing 0.07 M Tris-glycine, 0.105 M NaCl, pH 7.4, 0.035% sodium azide and 30% glycerol. Normal Rabbit IgG. One vial containing 125μg Rabbit IgG in 125μL of storage buffer containing 0.05% sodium azide. ChIP Primers, BDNF Intron. One vial containing 75μL of 5μM of each primer specific for human BDNF intron. FOR: ACCCCAACCTCTAACAGCATTA; REV: TGTCTCTCAGCAGTCTTGCATT
Immunogen KLH-conjugated,synthetic peptide containing the sequence ....GVme3KKP…,in which me3K corresponds to human trimethyl-histone H3 (Lys36).
Classification Monoclonal
Primary or Secondary Primary
Test Specificity Recognizes Trimethyl-Histone H3 (Lys36), Mr ∽17kDa.
8

MilliporeSigma™ Upstate™ Acetyl-Histone H4 (Lys5)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Content And Storage -20°C for one year from date of shipment; Upon first thaw and prior to removing the cap centrifuge the vial and gently mix the solution; Aliquot into microcentrifuge tubes and store at −20°C; Avoid repeated freeze/thaw cycles
Host Species Rabbit
Applications ChIP Assay,Immunoprecipitation,Western Blot
Form Culture Supernatant
Gene Accession No. P62805
Isotype IgG
Includes This ChIPAb+ Acetyl-Histone H4 (Lys5) -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen Acetyl-Histone H4 (Lys5)α
Regulatory Status RUO
Gene Symbols HIST1H4A, H4/J, HIST1H4F, HIST1H4L, H4FN, H4FA, H4FH, HIST1H4H, H4F2, H4FM, H4/A, H4FK, H4FG, HIST2H4, H4FB, H4/K, HIST1H4I, H4/N, HIST1H4B, H4FE, H4/M, H4/a, HIST1H4E, HIST4H4, HIST2H4A, H4FC, H4FI, H4/H, HIST1H4C, H4/G, HIST1H4K, H4FJ, H4FD, H4/I, H4/B, H4/D, H4/C, HIST1H4J, HIST1H4D, H4/E
Gene ID (Entrez) NP_001029249
Formulation Anti-Acetyl-Histone H4 (Lys5) (rabbit monoclonal IgG). One vial containing 50μL of rabbit monoclonal IgG cell culture supernatant in 0.1% sodium azide. Negative Control Supernatant (rabbit). One vial containing 50μL of cultured supernatant in 0.05% sodium azide. Control Primers. One vial containing 75μL of 5μM each primer specific for the human GAPDH promoter. FOR: TAC TAG CGG TTT TAC GGG CG; REV: TCG AAC AGG AGG AGC AGA GAG CGA
Immunogen Peptide corresponding to Histone H4 containing the sequence [GRG-AcK-GGK] on which Lys5 is acetylated.
Classification Monoclonal
Primary or Secondary Primary
Test Specificity Recognizes Histone H4 acetylated on Lys5.
9

MilliporeSigma™ RIPAb+™ hnRNP U RIP Validated Antibody and Primer Set

This RIPAb+ hnRNP U -RIP Validated Antibody and Primer Set conveniently includes the hnRNP U antibody and the specific control PCR primers.

10

Invitrogen™ ELISA TMB Stabilized Chromogen  DFS Item

For use with all sandwich ELISAs which utilize Horseradish Peroxidase (HRP) as detecting enzyme

11

MilliporeSigma™ RIPAb+™ STAU1 (Staufen 1) RIP Validated Antibody and Primer Set

This RIPAb+ STAU1 (Staufen 1) -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

12

MilliporeSigma™ Upstate™ Trimethyl-Histone H3 (Lys4)α, Rabbit Monoclonal, ChIP Validated Antibody and Primer Set

Rabbit Monoclonal Antibody

Content And Storage −20°C for one year from date of shipment
Host Species Rabbit
Applications ChIP Assay,ChIP sequencing (ChIP-seq),Western Blot
Form Purified
Gene Accession No. Q66I33
Isotype IgG
Includes Trimethyl-Histone H3 (Lys4) ChIP validated Antibody and Primer set including the ChIP-grade antibody and the specific control PCR primers used for chromatin immunoprecipitation of H3K4Me3.
Antigen Trimethyl-Histone H3 (Lys4)α
Regulatory Status RUO
Gene Symbols H3F3A, H3F3B, H3F3
Gene ID (Entrez) NM_003493
Formulation Anti-Trimethyl-Histone H3 (Lys4) recombin-ant rabbit monoclonal IgG. One vial containing 75μL of protein A purified rabbit IgG in storage buffer (0.1M Tris-Glycine pH 7.4, 0.15M NaCl, 0.05% NaN3, with the addition of 40% glycerol.
Normal Rabbit IgG. One vial containing 75μL of normal rabbit IgG.
Control Primers. One vial containing 75μL of 5μM of each primer specific for human GAPDH. FOR: TAC TAG CGG TTT TAC GGG CG REV: TCG AAC AGG AGG AGC AGA GAG CGA
Immunogen The trimethyl-histone H3 (Lys4) antibody is made against a BSA-conjugated,synthetic peptide containing the sequence …RT[me3K]QT… in which me3K corresponds to trimethyl-lysine 4 of human histone H3
Classification Monoclonal
Primary or Secondary Primary
Test Specificity Trimethyl-Histone H3 (Lys4)
13

MilliporeSigma™ Upstate™ Acetyl-Histone H4, Rabbbit Polyclonal, ChIP Validated Antibody and Primer Set

Rabbit Polyclonal Antibody

Content And Storage −20°C from date of receipt
Host Species Rabbit
Applications Multiplex,Functional Assay,Immunoassay,Western Blot
Form Serum
Gene Accession No. P62805
Includes This ChIPAb+ Acetyl-Histone H4 -ChIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.
Antigen Acetyl-Histone H4
Regulatory Status RUO
Gene ID (Entrez) NP_778224
Formulation Anti-Acetyl-Histone H4 (rabbit polyclonal IgG). One vial containing 100μL of antiserum containing 0.05% sodium azide. Normal Rabbit Serum. One vial containing 100μL antiserum containing 0.05% sodium azide. Control Primers. One vial containing 75μL of 5μM of each primer specific for for human GAPDH.
Immunogen The acetyl-histone H4 antiserum is made against a peptide corresponding to amino acids 2-19 of Tetrahymena histone H4.
Classification Polyclonal
Primary or Secondary Primary
Test Specificity Recognizes acetylated histone H4 of approximately 10kDa. Cross-reacts with acetylated histone H2B from Tetrahymena and weakly crossreacts with acetylated histone H2B from HeLa cells. May cross-react with other acetylated proteins.
14

MilliporeSigma™ RIPAb+™ FXR1 RIP Validated Antibody and Primer Set

This RIPAb+ FXR1 -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.

15

MilliporeSigma™ RIPAb+™ hnRNPA1 (M9 Region) RIP Validated Antibody and Primer Set

This RIPAb+ hnRNPA1 (M9 Region) -RIP Validated Antibody and Primer Set conveniently includes the antibody and the specific control PCR primers.