missing translation for 'onlineSavingsMsg'
Learn More

Invitrogen™ BLOCK-iT™ U6 RNAi Entry Vector Kit

Catalog No. K494500
Encompass
Change view
Click to view available options
Quantity:
20 constructions
1 product options available for selection
Product selection table with 1 available options. Use arrow keys to navigate and Enter or Space to select.
Catalog No. Quantity
K494500 20 constructions
Use arrow keys to navigate between rows. Press Enter or Space to select a product option. 1 options available.
1 options
Catalog No. K494500 Supplier Invitrogen™ Supplier No. K494500
Only null left

Includes

The BLOCK-iT™ U6 Entry Vector Kit contains two boxes. The cloning box contains four tubes of linearized vector at 5ng/tube, enough to complete 5 cloning reactions per tube. Also included are 250μL 10X annealing buffer, 20μL T4 DNA ligase, 80μL 5X DNA ligase buffer, 1.4ng lacZ control oligo, 10μL lyophilized lacZ control plasmid, 1.5mL DNase/RNase-free water, and 2μg each of forward and reverse sequencing primer.

Provides a simple, streamlined approach to cloning short hairpin RNA (shRNA) sequences for testing in transient transfections for RNA interference (RNAi)

An easy cloning process places an approx. 50-bp oligonucleotide DNA immediately following a U6 pol III type promoter. Expression of this RNAi cassette forms a shRNA molecule in the cell that will be processed and act as short interfering RNA (siRNA) that will generate the RNAi effect.

Delivery of the U6 RNAi Cassette
Once cloning is complete, the U6 Entry Vector is ready to be used immediately in transient transfections using a reagent such as Lipofectamine™ 2000. This makes this system ideal for initial shRNA screenings in many mammalian cell types. As an alternative in hard-to-transfect or non-dividing cell types, or to deliver to animal model systems, the RNAi cassette can easily be recombined into a BLOCK-iT Viral RNAi vector. For stable shRNA lentiviral delivery and expression, recombine the BLOCK-iT U6 Entry Vector with the pLenti6/BLOCK-iT RNAi Vector. For transient delivery to challenging cell types using adenoviral transduction, recombine with the pAd/BLOCK-iT RNAi Vector. Represents a preferred technique for analyzing gene down regulation.

Cloning, Gateway Cloning, RNAi, RNAi, Epigenetics and Non-Coding RNA Research, Vector-Based RNAi

Specifications

Product Type RNAi Entry Vector Kit
Content And Storage The BLOCK-iT™ U6 Entry Vector Kit contains two boxes. The cloning box contains four tubes of linearized vector at 5 ng/tube, enough to complete 5 cloning reactions per tube. Also included are 250 μl 10X annealing buffer, 20 μl T4 DNA ligase, 80 μl 5X DNA ligase buffer, 1.4 ng lacZ control oligo, 10 μl lyophilized lacZ control plasmid, 1.5 ml DNase/RNase-free water, and 2 μg each of forward and reverse sequencing primer. Store the vectors, buffers, control oligo and plasmid, water, and sequencing primers at -20°C. The One Shot™ box contains transformation reagents including twenty-one 50-μl aliquots of One Shot™ TOP10 Chemically Competent E. coli, S.O.C. medium, and a pUC19 supercoiled control plasmid. Store at -80°C. All reagents are guaranteed stable for 6 months when properly stored.
Cloning Method Gateway™
Constitutive or Inducible System Constitutive
Delivery Type Transfection
RNAi Type shRNA
Vector BLOCK-iT RNAi Vectors
Promoter U6
Format Kit
Product Line BLOCK-iT
Quantity 20 constructions
Show More Show Less
Can I use any Gateway entry vector to generate entry clones for use in RNAi applications?

No, you should use an entry vector that contains the elements necessary for RNA Polymerase III-dependent expression of your shRNA (i.e., Pol III promoter and terminator).

What is a dose response curve or kill curve? And can you outline the steps involved?

A dose response curve or kill curve is a simple method for determining the optimal antibiotic concentration to use when establishing a stable cell line. Untransfected cells are grown in a medium containing antibiotic at varying concentrations in order to determine the lowest amount of antibiotic needed to achieve complete cell death. The basic steps for performing a dose response curve or kill curve are as follows:

- Plate untransfected cells at 25% confluence, and grow them in a medium containing increasing concentrations of the antibiotic. For some antibiotics, you will need to calculate the amount of active drug to control for lot variation.
- Replenish the selective medium every 3-4 days. After 10-12 days, examine the dishes for viable cells. The cells may divide once or twice in the selective medium before cell death begins to occur.
- Look for the minimum concentration of antibiotic that resulted in complete cell death. This is the optimal antibiotic concentration to use for stable selection.

Can I create stable cell lines using pENTR/U6 entry vector or the pENTR/H1/TO vector?

Unfortunately, the pENTR/U6 vector does not contain a selection marker; therefore, only transient RNAi analysis may be performed. If you wish to generate stable cell lines, perform an LR reaction into an appropriate Gateway destination vector to generate expression clones.
The pENTR/H1/TO vector contains the Zeocin resistance gene to facilitate generation of cell lines that inducbily express the shRNA of interest. Perform a kill curve to determine the minimum concentration of Zeocin that is required to kill your untransfected mammalian cell line. Please note that Zeocin-sensitive cells do not round up and detach from the plate, but rather may increase in size, show abnormal cell shape, display presence of large empty vesicles in the cytoplasm, or show breakdown of plasma/nuclear membranes.

What loop sequence should I use when designing my shRNA for cloning? Do you have any guidelines I should follow?

You can use a loop sequence of any length ranging from 4 to 11 nucleotides, although short loops (i.e., 4-7 nucleotides) are generally preferred. Avoid using a loop sequence containing thymidines (Ts), as they may cause early termination. This is particularly true if the target sequence itself ends in one or more T nucleotides. Here are some loop sequences we recommend:

- 5' - CGAA - 3'
- 5' - AACG - 3'
- 5' - GAGA - 3'

What considerations regarding transcription initiation should I take when designing my shRNA for cloning?

Transcription of the shRNA initiates at the first base following the end of the U6 promoter sequence. In the top-strand oligo, the transcription initiation site corresponds to the first nucleotide following the 4 bp CACC sequence added to permit directional cloning. We recommend initiating the shRNA sequence at a guanosine (G) because transcription of the native U6 snRNA initiates at a G. Note the following:

- If G is part of the target sequence, then incorporate the G into the stem sequence in the top-strand oligo and add a complementary C to the 3' end of the top-strand oligo.
- If G is not the first base of the target sequence, we recommend adding a G to the 5' end of the top-strand oligo directly following the CACC overhang sequence. In this case, do not add the complementary C to the 3' end of the top-strand oligo. Note: We have found that adding the complementary C in this situation can result in reduced activity of the shRNA. Alternative, if use of a G to initiate transcription is not desired, use an adenosine (A) rather than C or T. Note, however, that use of any nucleotide other than G may affect initiation efficiency and position.

How do I order the shRNA for vector expression?

Please follow the steps outlined below:

- Visit RNAi Designer
- Enter an accession number or provide a nucleotide sequence
- Determine the region for target design: ORF, 5' UTR, or 3' UTR
- Choose database for Blast
- Choose minimum and maximum G/C percentage
Select vector and strand orientation and click “RNAi Design” to design shRNA.

What molar ratio do you recommend for ligating my ds oligo to the pENTR/U6 entry vector or pENTR/H1/TO vector?

For optimal results, use a 10:1 molar ratio of ds oligo insert:vector for ligation.

How can I check the integrity of my ds oligo once it is annealed?

We suggest running an aliquot of the annealed ds oligo (5 µL of the 500 nM stock) and comparing it to an aliquot of each starting single-stranded oligo (dilute the 200 µM stock 400-fold to 500 nM; use 5 µL for gel analysis). Be sure to include an appropriate molecular weight standard. We generally use the following gel and molecular weight standard:

- Agarose gel: 4% E-Gel (Cat. No. G5000-04)
- Molecular weight standard: 10 bp DNA Ladder (Cat. No. 10821-015)

When analyzing an aliquot of the annealed ds oligo reaction by agarose gel electrophoresis, we generally see the following:
- A detectable higher molecular weight band representing annealed ds oligo.
- A detectable lower molecular weight band representing unannealed single-stranded oligos. Note that this band is detected since a significant amount of the single-stranded oligo remains unannealed.

How do I anneal my single-stranded DNA oligos to create a ds oligo?

You will want to anneal equal amounts of the top- and bottom-strand oligos to generate the ds oligos. If your single-stranded oligos are supplied lyophilized, resuspend them in water or TE buffer to a final concentration of 200 µM before use. We generally perform the annealing reaction at a final single-stranded oligo concentration of 50 µM. Annealing at concentrations lower than 50 µM can significantly reduce the efficiency. Note that the annealing step is not 100% efficient; approximately half of the single-stranded oligos remain unannealed even at a concentration of 50 µM. Please see the steps below:

1. In a 0.5 mL sterile microcentrifuge tube, set up the following annealing reaction at room temperature.
“Top-strand” DNA oligo (200 µM) - 5 µL, “Bottom-strand” DNA oligo (200 µM)- 5 µL, 10X Oligo Annealing Buffer - 2 µL, DNase/RNase-Free Water - 8 µL which should make a total volume of 20 µL.
2. If reannealing the lacZ ds control oligo, centrifuge its tube briefly (approximately 5 seconds), then transfer the contents to a separate 0.5 mL sterile microcentrifuge tube.
3. Incubate the reaction at 95 degrees C for 4 minutes.
4. Remove the tube containing the annealing reaction from the water bath or the heat block, and set it on your laboratory bench.
5. Allow the reaction mixture to cool to room temperature for 5-10 minutes. The single-stranded oligos will anneal during this time.
6. Place the sample in a microcentrifuge and centrifuge briefly (approximately 5 seconds). Mix gently.
7. Remove 1 µL of the annealing mixture and dilute the ds oligo as directed.
8. Store the remainder of the 50 µM ds oligo mixture at -20 degrees C.
You can verify the integrity of your annealed ds oligo by agarose gel electrophoresis, if desired.

What do I need to order to use your pENTR/U6 entry vector or pENTR/H1/TO vector?

You will need a double-stranded oligo that encodes the shRNA of interest to be cloned into one of the above-mentioned vectors. Use our RNAi Designer to design and synthesize two complementary single-stranded DNA oligonucleotides, with one encoding the shRNA of interest.

What does TO stand for in the pENTR/H1/TO vector?

TO stands for tetracycline operator, as this entry vector contains elements required for tetracycline-inducible expression of the shRNA in mammalian cells. The presence of the Tet operator sequences enables the shRNA of interest to be expressed in a tetracycline-dependent manner, thereby making this an inducible system.

What is the difference between the H1 and the U6 promoters?

The BLOCK-iT Inducible H1 and U6 Entry Vector Kits use either the Pol III-dependent H1 or the U6 promoter, respectively. The H1 promoter is modified to contain two flanking tetracycline operator (TetO2) sites within the H1 promoter. This allows the shRNA expressed from this promoter to be regulated in cells that express the tetracycline repressor (TR) protein. Both the H1 and the U6 are Pol III type promoters; however, there may be some minor differences in their effectiveness, depending on the cell line used.

What vectors do you offer for shRNA?

We offer our pENTR/U6 (Cat. No. K494500) and pENTR/H1/TO (Cat. No. K492000) vectors for shRNA delivery. Both vectors are Gateway compatible and drive expression through either the U6 or H1/TO promoter, respectively. The pENTR/H1/TO vector is for inducible shRNA expression, while the pENTR/U6 can be used for constitutive expression. If you want to design shRNA oligos compatible with both vectors, select the pENTER/U6 vector.

What are the general features of shRNA?

Exogenous short hairpin RNAs can be transcribed by RNA Polymerase III (Paule and White, 2000) and generally contain the following structural features: A short nucleotide sequence ranging from 19-29 nucleotides derived from the target gene, followed by a short spacer of 4-15 nucleotides (i.e., loop) and a 19-29 nucleotide sequence that is the reverse complement of the initial target sequence. The resulting RNA molecule forms an intramolecular stem-loop structure that is then processed to an siRNA duplex by the Dicer enzyme.

What does shRNA stand for, and how does it work?

Short hairpin RNA (shRNA) is an artificially designed class of RNA molecules that can trigger gene silencing through interaction with cellular components common to the RNAi and miRNA pathways. Although shRNA is a structurally simplified form of miRNA, these RNA molecules behave similarly to siRNA in that they trigger the RNAi response by inducing cleavage and degradation of target transcripts (Brummelkamp et al., 2002; Paddison et al., 2002; Paul et al., 2002; Sui et al., 2002; Yu et al., 2002). An RNA Polymerase III (Pol III), such as U6 and H1, drives transcription of shRNA transcripts. shRNA hairpins are exported from the nucleus and processed by Dicer into the cytosol, resulting in siRNA.

Why is a Pol III type promoter used for BLOCK-iT shRNA?

For efficient shRNA expression, a Pol III type promoter is used. These Pol III promoters contain all of their essential elements upstream of the expressed RNA and terminate with a short polythymidine tract. Once the shRNA is expressed, it is transported from the nucleus and processed into siRNA in the cytoplasm by the enzyme Dicer. Dicer preferentially recognizes shRNAs generated from a Pol III promoter because they carry no 5' or 3' flanking sequences. The siRNAs enter into RISC complexes and generate an RNAi response in mammalian cells.

How large of a PCR product can I recombine with a pDONR vector via BP cloning? Does the same apply for TOPO-adapted Entry vectors?

There is no theoretical limit to insert size for a BP reaction with a pDONR vector. Maximum size tested in-house is 12 kb. TOPO vectors are more sensitive to insert size and 3-5 kb is the upper limit for decent cloning efficiency.

How should I clean up my attB-PCR product?

After generating your attB-PCR product, we recommend purifying it to remove PCR buffer, unincorporated dNTPs, attB primers, and any attB primer-dimers. Primers and primer-dimers can recombine efficiently with the Donor vector in the BP reaction and may increase background after transformation into E. coli, whereas leftover PCR buffer may inhibit the BP reaction. Standard PCR product purification protocols using phenol/chloroform extraction followed by ammonium acetate and ethanol or isopropanol precipitation are not recommended for purification of the attB-PCR product as these protocols generally have exclusion limits of less than 100 bp and do not efficiently remove large primer-dimer products. We recommend a PEG purification protocol (see page 17 of the Gateway Technology with Clonase II manual). If you use the above protocol and your attB-PCR product is still not suitably purified, you may further gel-purify the product. We recommend using the PureLink Quick Gel Extraction kit.

I'm trying to propagate my Gateway destination vector and am not seeing any colonies. What should I do?

Check the genotype of the cell strain you are using. Our Gateway destination vectors typically contain a ccdB cassette, which, if uninterrupted, will inhibit E. coli growth. Therefore, un-cloned vectors should be propagated in a ccdB survival cell strain, such as our ccdB Survival 2 T1R competent cells.

What is the difference between LR Clonase II and LR Clonase II Plus?

LR Clonase II Plus contains an optimized formulation of recombination enzymes for use in MultiSite Gateway LR reactions. LR Clonase and LR Clonase II enzyme mixes are not recommended for MultiSite Gateway LR recombination reactions, but LR Clonase II Plus is compatible with both multi-site and single-site LR recombination reactions.

How do the BLOCK-iT shRNA products compare to the BLOCK-iT miR RNAi system?

Both systems are used for gene targeting or gene knockdown but each has distinctive features. The shRNA expression vectors like pENTR/U6 or pENTR/H1-TO use Pol III promoters, whereas the miRNA expression vectors are flexible to use more common and more processive Pol II promoters like CMV, EF1 or other mammalian expression promoters. You can only clone a single shRNA sequence into an shRNA vector to target a single gene, whereas multiple miRNA sequences can be cloned together into an miRNA vector to target one or more genes, or multiple locations in a gene. An additional feature of the miRNA expression vectors is that, due to use of Pol II promoters, the miRNA can be expressed directly in fusion with a reporter gene like EmGFP to monitor transfection and transcription.

What is the purpose of the Proteinase K step following a Gateway LR Recombination reaction, and is it critical to the results?

When the LR reaction is complete, the reaction is stopped with Proteinase K and transformed into E. coli resulting in an expression clone containing a gene of interest. A typical LR reaction followed by Proteinase K treatment yields about 35,000 to 150,000 colonies per 20ul reaction. Without the Proteinase K treatment, up to a 10 fold reduction in the number of colonies can be observed. Despite this reduction, there are often still enough colonies containing the gene of interest to proceed with your experiment, so the Proteinase K step can be left out after the LR reaction is complete if necessary.

Can I go directly from a pENTR/D-TOPO reaction into an LR Clonase Reaction without first purifying the DNA?

In most cases, there will not be enough pENTR vector DNA present to go directly from TOPO cloning into an LR reaction. You need between 100-300 ng of pENTR vector for an efficient LR reaction, and miniprep of a colony from the TOPO transformation is necessary to obtain that much DNA. However, if you want to try it, here are some recommendations for attempting to go straight into LR reactions from the TOPO reaction using pENTR/D, or SD TOPO, or pCR8/GW/TOPO vectors:

1. Heat inactivate the topoisomerase after the TOPO cloning reaction by incubating the reaction at 85 degrees C for 15 minutes.
2. Use the entire reaction (6 µL) in the LR clonase reaction. No purification steps are necessary.
3. Divide the completed LR reaction into 4 tubes and carry out transformations with each tube. You cannot transform entire 20 µL reaction in one transformation, and we have not tried ethanol precipitation and then a single transformation.

When attempting this protocol, we observed very low efficiencies (~10 colonies/plate). So just be aware that while technically possible, going directly into an LR reaction from a TOPO reaction is very inefficient and will result in a very low colony number, if any at all.

Can N-terminal or C-terminal tags be attached to a Gateway Entry clone?

To have an N-terminal tag, the gene of interest must be in the correct reading frame when using non-TOPO adapted Gateway entry vectors. All TOPO adapted Gateway Entry vectors will automatically put the insert into the correct reading frame, and to add the N-terminal tag you simply recombine with a destination vector that has N-terminal tag.

To attach a C-terminal tag to your gene of interest, the insert must lack its stop codon, and be in the correct reading frame for compatibility with our C-terminal tagged destination vectors. Again, TOPO adapted Gateway Entry vectors will automatically put the insert into the correct reading frame. If you do not want the C-terminal tag to be expressed, simply include a stop codon at the end of the insert that is in frame with the initial ATG.

Generally, you need to choose a destination vector before you design and clone your insert into the Entry vector. This will determine whether you need to include an initiating ATG or stop codon with your insert.

Can an attB-PCR product be cloned directly into an expression (Gateway Destination) vector?

No, not directly. The attB-PCR product must first be cloned, via a BP Clonase reaction, into a pDONR vector which creates an "Entry Clone" with attL sites. This clone can then be recombined, via an LR Clonase reaction, with a Destination vector containing attR sites. However, It is possible to perform both of these reactions in one step using the "One-Tube Protocol" described in the manual entitled "Gateway Technology with Clonase II".

Can Gateway technology be used to express two proteins from the same vector?

Yes, this can be done using the Multisite Gateway Technology. MultiSite Gateway Pro Technology enables you to efficiently and conveniently assemble multiple DNA fragments - including genes of interest, promoters, and IRES sequences - in the desired order and orientation into a Gateway Expression vector. Using specifically designed att sites for recombinational cloning, you can clone two, three, or four DNA fragments into any Gateway Destination vector containing attR1 and attR2 sites. The resulting expression clone is ready for downstream expression and analysis applications.

What is the efficiency of recombination in the Gateway system?

For the BP reaction, approximately 5-10% of the starting material is converted into product. For the LR reaction, approximately 30% of the starting material is converted into product.

Are there common restriction sites that can be used to excise a gene out of a Gateway plasmid?

The core region of the att sites contains the recognition sequence for the restriction enzyme BsrGI. Provided there are no BsrGI sites in the insert, this enzyme can be used to excise the full gene from most Gateway plasmids. The BsrGI recognition site is 5'-TGTACA and is found in both att sites flanking the insertion site.

If a different restriction site is desired, the appropriate sequence should be incorporated into your insert by PCR.

Do I have to synthesize new attB primers (29 base attB primer + my specific sequence primer) each time I want to make an attB PCR product, or do you have truncated attB primers that work together with adapter attB primers to get a complete attB sequence?

We do have an alternative method called the "attB Adapter PCR" Protocol in which you make your gene specific primer with only 12 additional attB bases and use attB universal adapter primers. This protocol allows for shorter primers to amplify attB-PCR products by utilizing four primers instead of the usual two in a PCR reaction. You can find the sequence of these primers in the protocol on page 45 of the "Gateway Technology with Clonase II" manual.

There is a protocol in which all 4 primers mentioned above are in a single PCR reaction. You can find this protocol at in the following article: Quest vol. 1, Issue 2, 2004. https://www.thermofisher.com/us/en/home/references/newsletters-and-journals/quest-archive.reg.in.html. The best ratio of the first gene-specific and the second attB primers was 1:10.

Do you have recommended sequencing primers for pDONR201?

We do not offer pre-made primers, but we can recommend the following sequences that can be ordered as custom primers for sequencing of pDONR201:
Forward primer, proximal to attL1: 5'- TCGCGTTAACGCTAGCATGGATCTC
Reverse primer, proximal to attL2: 5'-GTAACATCAGAGATTTTGAGACAC

Can you please list some references for Gateway Cloning Technology?

1. Yeast two-hybrid protein-protein interaction studies Walhout AJ, Sordella R, Lu X, Hartley JL, Temple GF, Brasch MA, Thierry-Mieg N, Vidal M.

2. Protein Interaction Mapping in C. elegans Using Proteins Involved in Vulval Development. Science Jan 7th 2000; 287(5450), 116-122 Davy, A. et al.

3. A protein-protein interaction map of the Caenorhabditis elegans 26S proteosome. EMBO Reports (2001) 2 (9), p. 821-828. Walhout, A.J.M. and Vidal, M. (2001).

4. High-throughput Yeast Two-Hybrid Assays for Large-Scale Protein Interaction mapping. Methods: A Companion to Methods in Enzymology 24(3), pp.297-306

5. Large Scale Analysis of Protein Complexes Gavin, AC et al. Functional Organization of the Yeast Proteome by Systematic Analysis of Protein Complexes. Nature Jan 10th 2002, 415, p. 141-147.

6. Systematic subcellular localisation of proteins Simpson, J.C., Wellenreuther, R., Poustka, A., Pepperkok, R. and Wiemann, S.

7. Systematic subcellular localization of novel proteins identified by large-scale cDNA sequencing. EMBO Reports (2000) 1(3), pp. 287-292.

8. Protein-over expression and crystallography Evdokimov, A.G., Anderson, D.E., Routzahn, K.M. & Waugh, D.S.

9. Overproduction, purification, crystallization and preliminary X-ray diffraction analysis of YopM, an essential virulence factor extruded by the plague bacterium Yersinia pestis. Acta Crystallography (2000) D56, 1676-1679.

10. Evdokimov, et al. Structure of the N-terminal domain of Yersinia pestis YopH at 2.0 A resolution. Acta Crystallographica D57, 793-799 (2001).

11. Lao, G. et al. Overexpression of Trehalose Synthase and Accumulation of Intracellular Trehalose in 293H and 293FTetR:Hyg Cells. Cryobiology 43(2):106-113 (2001).

12. High-throughput cloning and expression Albertha J. M. Walhout, Gary F. Temple, Michael A. Brasch, James L. Hartley, Monique A. Lorson, Sander Van Den Huevel, and Marc Vidal.

13. Gateway Recombinational Cloning: Application to the Cloning of Large Numbers of Open Reading Frames or ORFeomes. Methods in Enzymology, Vol. 328, 575-592.

14. Wiemann, S. et.al., Toward a Catalog of Human Genes and Proteins: Sequencing and Analysis of 500 Novel Complete Protein Coding Human cDNAs, Genome Research (March 2001) Vol. 11, Issue 3, pp.422-435

15. Reviewed in NATURE: Free Access to cDNA provides impetus to gene function work. 15 march 2001, p. 289. Generating directional cDNA libraries using recombination

16. Osamu Ohara and Gary F. Temple. Directional cDNA library construction assisted by the in vitro recombination reaction. Nucleic Acids Research 2001, Vol. 29, no. 4. RNA interference (RNAi)

17. Varsha Wesley, S. et al. Construct design for efficient, effective and highthroughput gene silencing in plants. The Plant Journal 27(6), 581-590 (2001). Generation of retroviral constructs

18. Loftus S K et al. Generation of RCAS vectors useful for functional genomic analyses. DNA Res 31;8(5):221 (2001).

19. James L. Hartley, Gary F. Temple and Michael A. Brasch. DNA Cloning Using In Vitro Site-Specific Recombination. Genome Research (2000) 10(11), pp. 1788-1795.

20. Reboul et al. Open-reading frame sequence tags (OSTs) support the existence of at least 17,300 genes in C. elegans. Nature Genetics 27(3):332-226 (2001).

21. Kneidinger, B. et al. Identification of two GDP-6-deoxy-D-lyxo-4-hexulose reductase synthesizing GDP-D-rhamnose in Aneurinibacillus thermoaerophilus L420-91T*. JBC 276(8) (2001).

What do attL1 and attL2 sites look like after recombination between attB and attP sites?

The attP1 sequence (pDONR) is:
AATAATGATT TTATTTTGAC TGATAGTGAC CTGTTCGTTG CAACAAATTG ATGAGCAATGCTTTTTTAT AATGCCAACT TTGTACAAAA AAGC[TGAACG AGAAACGTAA AATGATATAA ATATCAATAT ATTAAATTAG ATTTTGCATA AAAAACAGACTA CATAATACTG TAAAACACAA CATATCCAGT CACTATGAAT CAACTACTTA GATGGTATTA GTGACCTGTA]

The region within brackets is where the site is "cut" and replaced by the attB1-fragment sequence to make an attL1 site. The sequence GTACAAA is the overlap sequence present in all att1 sites and is always "cut" right before the first G.

The overlap sequence in attP2 sites is CTTGTAC and cut before C. This is attP2:
ACAGGTCACT AATACCATCT AAGTAGTTGA TTCATAGTGA CTGGATATGT TGTGTTTTAC AGTATTATGT AGTCTGTTTT TTATGCAAAA TCTAATTTAA TATATTGATA TTTATATCAT TTTACGTTTC TCGTTCAGCT TTCTTGTACA AAGTTGGCAT TATAAGAAAG CATTGCTTAT AATTTGTTG CAACGAACAG GTCACTATCA GTCAAAATAA AATCATTATT

So, attL1 (Entry Clone) should be:
A ATAATGATTT TATTTTGACT GATAGTGACC TGTTCGTTGC AACAAATTGA TGAGCAATGC TTTTTTATAA TGCCAACT TT G TAC AAA AAA GC[A GGC T]NN NNN

attL2 (Entry Clone) should be:
NNN N[AC C]CA GCT TT CTTGTACA AAGTTGGCAT TATAAGAAAG CATTGCTTAT CAATTTGTTG CAACGAACAG GTCACTATCA GTCAAAATAA AATCATTATT

The sequence in brackets comes from attB, and N is your gene-specific sequence.

Note: When creating an Entry Clone through the BP reaction and a PCR product, the vector backbone is not the same as Gateway Entry vectors. The backbone in the case of PCR BP cloning is pDONR201.

How large can PCR fragments be and still be cloned into a Gateway Entry vector?

There is no size restriction on the PCR fragments if they are cloned into a pDONR vector. The upper limit for efficient cloning into a TOPO adapted Gateway Entry vector is approximately 5 kb. A Gateway recombination reaction can occur between DNA fragments that are as large as 150 kb.

What is the influence of the attB sequence on protein function, solubility, folding, and expression?

Destination vectors that contain N-terminal fusion partners will express proteins that contain amino acids contributed from the attB1 site, which is 25 bases long. This means that in addition to any tag (6x His and/or antibody epitope tag), the N-terminus of an expressed protein will contain an additional 9 amino acids from the attB1 sequence - the typical amino acid sequence is Thr-Ser-Leu-Tyr-Lys-Lys-Ala-Gly-nnn, where nnn will depend on the codon sequence of the insert.

Effects on protein function: A researcher (Simpson et al. EMBO Reports 11(31):287-292, 2000) demonstrated that GFP fusions (N- terminal and C-terminal) localized to the proper intracellular compartment. The expression constructs were generated using Gateway cloning, so the recombinant protein contained the attB1 or attB2 amino acid sequence. The localization function of the cloned recombinant proteins was preserved.

Effects on expression: We have seen no effect of the attB sites on expression levels in E. coli, insect and mammalian cells. The gus gene was cloned into bacterial expression vectors (for native and N-terminal fusion protein expression) using standard cloning techniques and expressed in bacteria. Gus was also cloned into Gateway Destination vectors (for native and N-terminal fusion expression) and expressed. When protein expression is compared, there was no difference in the amount of protein produced. This demonstrates that for this particular case, the attB sites do not interfere with transcription or translation.

Effects on solubility: A researcher at the NCI has shown that Maltose Binding Protein fusions constructed with Gateway Cloning were soluble. The fusion proteins expressed had the attB amino acid sequence between the Maltose Binding Protein and the cloned protein. It is possible that some proteins containing the attB sequence could remain insoluble when expressed in E.coli.

Effects on folding: Two Hybrids screens show the same interacters identified with and without the attB sequence. Presumably correct protein folding would be required for protein-protein interactions to take place. It is possible that some proteins containing the attB sequence may not fold correctly.

Must PCR conditions be changed once the original PCR primers have attB sequence added to them?

Since the attB sequences are on the 5' end of oligos, they will not anneal to the target template in the first round of PCR. Sometimes the PCR product is more specific with the attB primers, probably due to the longer annealing sequence (all of attB plus gene specific sequence) after the first round of amplification. Generally there is no need to change PCR reaction conditions when primers have the additional attB sequence

Can PCR primers be tailed directly with attL sites for direct recombination into the destination vector?

No, this is not really feasible due to the fact that the attL sequence is approximately 100 bp, which is too long for efficient oligo synthesis. Our own maximum sequence length for ordering custom primers is 100 nucleotides. In contrast, the attB sequences are only 25 bp long, which is a very reasonable length for adding onto the 5' end of gene-specific PCR primers.

Where can I get Gateway vector sequences and maps?

Vector information can be found in the product manuals or directly on our web site by entering the catalog number of the product in the search box. The vector map, cloning site diagram, and sequence information will be linked to the product page.

From where does Gateway get its lambda nomenclature, and is it consistent with textbook nomenclature for lambda recombination?

The Gateway nomenclature is consistent with lambda nomenclature, but we use numbers to differentiate between modified versions of the att sites (attB1, attB2, attP1, attP2, and so on). We have introduced mutations in the att sites to provide specificity and directionality to the recombination reaction. For example, attB1 will only recombine with attP1 and not with attP2.

What is the first step in an experiment with the Gateway system?

The first step is to create an Entry clone for your gene of interest. We have 3 options to do this: The first is by BP recombination reaction using the PCR Cloning System with Gateway Technology. This is recommended for cloning large (>5 kb) PCR products. We also have Gateway compatible TOPO Cloning vectors such as pCR8/GW/TOPO and pENTR/D-TOPO. The final option is to use restriction enzymes to clone into a pENTR Dual Selection vector.

What are the prerequisites for Gateway cloning and expression?

The gene of interest must be flanked by the appropriate att sites, either attL (100 bp) in an Entry clone or attB (25 bp) in a PCR product. For Entry clones, everything between the attL sites will be shuttled into the Gateway destination vector containing attR sites, and a PCR product flanked by attB sites must be shuttled into an attP-containing donor vector such as pDONR221.

The location of translation initiation sites, stop codons, or fusion tags for expression must be considered in your initial cloning design. For example, if your destination vector contains an N-terminal tag but does not have a C-terminal tag, the vector should already contain the appropriate translation start site but the stop codon should be included in your insert.

Will increasing the Gateway cloning reaction time improve recombination efficiency?

Yes, increasing the incubation time from 1 hour to 4 hours will generally increase colony numbers 2-3 fold. An overnight incubation at room temperature will typically increase colony yield by 5-10 fold.

How many times can I thaw BP Clonase II and LR Clonase II?

BP Clonase II and LR Clonase II can be freeze/thawed at least 10 times without significant loss of activity. However, you may still want to aliquot the enzymes to keep freeze/thaw variability to a minimum.

These enzymes are more stable than the original BP and LR Clonase and can be stored at -20 degrees C for 6 months.

How clean must my DNA be to use in a Gateway cloning reaction?

Mini-prep (alkaline lysis) DNA preparations work well in Gateway cloning reactions. It is important that the procedure remove contaminating RNA for accurate quantification. Plasmid DNA purified with our S.N.A.P. nucleic acid purification kits, ChargeSwitch kits, or PureLink kits are recommended.

How would you incorporate a leader sequence for secretion into an entry vector?

A simple way to express a protein with a leader sequence is to have the leader sequence encoded in the destination vector. The other option is to have the leader sequence subcloned into the entry vector using restriction enzymes, or incorporate the leader sequence into the forward PCR primer when cloning a PCR product into the entry vector. Please see Esposito et al. (2005), Prot. Exp. & Purif. 40, 424-428 for an example of how a partial leader sequence for secretion was incorporated into an entry vector.

Where is the ATG relative to the 5' attB site in a Gateway expression clone?

This depends on whether you are expressing a fusion or a native protein in the Gateway destination vector. For an N-terminal fusion protein the ATG will be given by the destination vector and it will be upstream of the attB1 site. For a C-terminal fusion protein or a native protein, the ATG should be provided by your gene of interest, and it will be downstream of the attB1 site.

Are the Gateway attB1 and attB2 sites the same as the attB site used for recombination into E. coli by bacteriophage lambda?

The Gateway attB sites are derived from the bacteriophage lambda site-specific recombination, but are modified to remove stop codons and reduce secondary structure. The core regions have also been modified for specificity (i.e., attB1 will recombine with attP1 but not with attP2).

Will Gateway att sites affect the expression of my protein?

Expression experiments have shown that the extra amino acids contributed by the attB site to a fusion protein will most likely have no effect on protein expression levels or stability. In addition, they do not appear to have any effect on two-hybrid interactions in yeast. However, as is true with the addition of any extra sequences that result from tags, the possible effects will be protein-dependent.

Can the attB primers anneal in a non-specific manner?

No, attB primers are highly specific under standard PCR conditions. We have amplified from RNA (RT-PCR), cDNA libraries, genomic DNA, and plasmid templates without any specificity problems.

What is the smallest fragment that can be used in a Gateway reaction?

The smallest size we have recombined is a 70 bp piece of DNA located between the att sites. Very small pieces are difficult to clone since they negatively influence the topology of the recombination reaction.

Are there any limitations on the insert length in Gateway cloning?

There is no theoretical size limitation. PCR products between 100 bp and 11 Kb have been readily cloned into a pDONR Gateway vector. Other DNA pieces as large as 150 kb with att sites will successfully recombine with a Gateway-compatible vector. Overnight incubation is recommended for large inserts.

What primer purity should be used for adding attB sites to my PCR product?

Standard desalted purity is generally sufficient for creating attB primers. We examined HPLC-purified oligos for Gateway cloning (about 50 bp long) and found only about a 2-fold increase in colony number over standard desalted primers. If too few colonies are obtained, you may try to increase the amount of PCR product used and/or incubate the BP reaction overnight.

I'm getting no fluorescence signal with my expression clone containing EmGFP. What should I do?

Please ensure that the recommended filter sets for detection of fluorescence are used. Use an inverted fluorescence microscope for analysis. If desired, allow the protein expression to continue for 1-3 days before assaying for fluorescence.

I'm seeing nonspecific, off-target gene knockdown. What should I do?

The target sequence used may contain strong homology to other genes; please select a different target region.

I am not getting any colonies after titering. What would suggest I try?

Perform a kill curve to determine the antibiotic sensitivity of your cell line. Ensure that viral stocks are stored properly at -80 degrees C, and do not undergo freeze/thaw more than 3 times. Lastly, transducer the lentiviral contruct into cells in the presence of Polybrene reagent.

I'm getting few or no colonies, even with the transformation control. What could be the cause of this?

Ensure that the competent cells used were stored properly at -80 degrees C, and thawed on ice for immediate use. When adding DNA, mix competent cells gently: do not mix by pipetting up and down. Also do not exceed the maximum recommended amount of DNA for transformation (100 ng) or allow the volume of DNA added to exceed 10% of the volume of the competent cells, as these may inhibit the transformation.

I'm seeing some basal expression of my shRNA of interest in the absence of tetracycline induction when using the BLOCK-iT H1 construct or pLenti4/BLOCK-iT-DEST construct. What could be causing this?

Please check to ensure that your medium containing fetal bovine serum (FBS) is reduced in tetracycline. Many lots of FBS contain tetracycline, as FBS is often isolated from cows that have been fed a diet containing tetracycline, leading to low basal expression of shRNA. Ensure that a cell line expressing the Tet repressor is being used, and that the cells used are transduced at a suitable MOI. If creating your own Tet repressor-expressing cell line, wait at least 24 hours before transducing cells with your shRNA construct.

I'm seeing a low level of gene knockdown or no gene knockdown. What can you suggest I try?

Low expression levels can be due to several factors. Please see the suggestions below:

- Low transfection efficiency: ensure that antibiotics are not added to the media during transfection, and that cells are at the proper cell confluency; optimize transfection conditions by varying the amount of transfection reagent used.
- Try a time course assay to determine the point at which the highest degree of gene knockdown occurs.
- Mutations are present in your construct: analyze the transformants by sequencing the ds oligo insert to verify its sequence.
- Target region is not optimal: select a different target region.
- Ensure siRNA is designed according to guidelines listed in the respective manual.

I'm seeing cytotoxic effects after transfection of my shRNA/miRNA construct. What is causing this?

You can try to scale back the amount of transfection reagent used, or use a different reagent for the transfection. Additionally, ensure that the plasmid used is pure and properly prepared for transfection.

I'm having difficulty sequencing the ds oligo insert in my shRNA construct. What is causing this, and do you have any suggestions on how to improve my sequencing results?

Difficulties sequencing could occur because the hairpin sequence is an inverted repeat that can form secondary structure during sequencing, resulting in a drop in the sequencing signal when entering the hairpin. If you encounter difficulties while sequencing, please try the following:

- Use high-quality, purified plasmid DNA for sequencing. We recommend preparing DNA using the Invitrogen PureLink HQ Mini Plasmid Purification Kit (Cat. No. K2100-01) or S.N.A.P. Plasmid DNA MidiPrep Kit (Cat. No. K1910-01).
- Add DMSO to the sequencing reaction to a final concentration of 5%.
- Increase the amount of template used in the reaction (up to twice the normal concentration).
- Standard sequencing kits typically use dITP in place of dGTP to reduce G:C compression. Other kits containing dGTP are available for sequencing G-rich and GT-rich templates. If you are using a standard commercial sequencing kit containing dITP, obtain a sequencing kit containing dGTP (e.g., dGTP BigDye Terminator v3.0 Ready Reaction Cycle Sequencing Kit, Cat. No. 4390229) and use a 7:1 molar ratio of dITP:dGTP in your sequencing reaction.

I'm trying to create my entry clone but am seeing mutated inserts. What should I do?

We highly recommend sequencing positive transformants to confirm the sequence of the ds oligo insert. When screening transformants, we find that up to 20% of the clones may contain mutated inserts (generally 1 or 2 bp deletions within the ds oligo). The reason for this is not known, but may be due to triggering of repair mechanisms within E. coli as a result of the inverted repeat sequence within the ds oligo insert. Note: Entry clones containing mutated ds oligo inserts generally elicit a poor RNAi response in mammalian cells. Identify entry clones with the correct ds oligo sequence and use these clones for your RNAi analysis.
Mutated inserts could also be caused by using poor-quality single-stranded oligos. Use mass spectrometry to check for peaks of the wrong mass, or order HPLC- or PAGE-purified oligos to avoid this problem.

I'm trying to anneal my oligos to create a ds oligo for ligation into one of your shRNA or miRNA RNAi vectors. When I run my ligated ds oligo on an agarose gel, I do not see any bands representing the ds oligo. What could be happening?

- Verify that the sequence of the bottom-strand oligo is complementary to the sequence of the top-strand oligo.
- For the shRNA vectors, make sure that you mix single-stranded oligos with complementary sequences. The top-strand oligo should include CACC on the 5' end, while the bottom-strand oligo should include AAAA on the 5' end.
- For the miRNA vectors, make sure that the top-strand oligo includes TGCT at the 5' end and that the bottom-strand oligo includes CCTG at the 5' end.

I'm trying to anneal my oligos to create a ds oligo for ligation into one of your shRNA or miRNA RNAi vectors. When I run my ligated ds oligo on an agarose gel, the bands are weak. What could be happening?

Please review the possibilities below:

- Single-stranded oligos designed incorrectly; verify that the sequence of the bottom-strand oligo is complementary to the sequence of the top strand oligo.
- Ensure that oligos are annealed at room temp for 5-10 minutes after heating to 95 degrees C.
- Check the molar ratio you are using for annealing top and bottom-strand oligo; equal amounts should be used.


For Research Use Only. Not for use in diagnostic procedures.