missing translation for 'onlineSavingsMsg'
Learn More

Applied Biosystems™ TaqMan™ Advanced miRNA Assay

Catalog No. A25576
Encompass
Change view
Click to view available options
Quantity:
S (250 reactions), inventoried
1 product options available for selection
Product selection table with 1 available options. Use arrow keys to navigate and Enter or Space to select.
Catalog No. Quantity
A25576 S (250 reactions), inventoried
Use arrow keys to navigate between rows. Press Enter or Space to select a product option. 1 options available.
1 options
Catalog No. A25576 Supplier Applied Biosystems™ Supplier No. A25576
Only null left

Applied Biosystems TaqMan Advanced miRNA Assays enable highly sensitive and specific quantification of mature miRNAs using qPCR.

Applied Biosystems TaqMan Advanced miRNA Assays enable highly sensitive and specific quantification of mature miRNAs using qPCR. Together with the TaqMan Advanced miRNA cDNA Synthesis Kit, this solution provides a streamlined upfront workflow that is ideal for analysis of multiple miRNA targets from a single sample or low-level RNA samples such as serum and plasma.

  • Universal RT—one RT step for all TaqMan Advanced miRNA Assays
  • Sensitivity—detect as few as 60 copies input into cDNA synthesis
  • Specificity—detect only the mature miRNA and distinguish between highly homologous targets
  • Small sample input—detect and quantify mature miRNA from as little as 1 pg total RNA or 2 μL plasma
  • Compatibility with biofluids including human serum, plasma, and tissue

Pre-formulated assay

  • 2 unlabeled PCR primers (900 nM each final 1X concentration)
  • 1 FAM dye-labeled TaqMan MGB probe (250 nM final 1X concentration)

TaqMan miRNA Assay selection guide

TaqMan MicroRNA Assays

  • Description: TaqMan MicroRNA Assays employ a novel target-specific stem–loop primer during cDNA synthesis to produce a template for real-time PCR
  • RT chemistry: miRNA-specific RT
  • Throughput: Best for 1–10 targets
  • Coverage: 205 species available, coverage for miRBase v.21

TaqMan Advanced miRNA Assays

  • Description: TaqMan Advanced miRNA Assays employ a universal RT step for a streamlined workflow, and a universal miR-Amp step to enable highly sensitive detection by real-time PCR
  • RT chemistry: Universal RT
  • Throughput: Best for > 10 targets
  • Coverage: All human, mouse, and rat miRNAs; coverage for miRBase v.21

Order Info

Ambient Temperature

Specifications

Concentration 20X
Content And Storage 1 tube containing a 20X mix of pre-formulated assay (1 probe and 2 primers).

Store at -15 to -25°C.

Detection Method Primer-probe
Format Tube
GC-Rich PCR Performance High
PCR Method qPCR
Reaction Speed Standard
For Use With (Equipment) 7500 System, 7500 Fast System, 7900HT System, StepOne™, StepOnePlus™, ViiA™ 7 System, QuantStudio™ 3, QuantStudio™ 5, QuantStudio™ 6 Flex, QuantStudio™ 7 Flex, QuantStudio 6 Pro, QuantStudio 7 Pro, QuantStudio™ 12k Flex, QuantStudio™ Absolute Q Digital PCR System
Product Line TaqMan
Product Type Advanced miRNA Assay
Quantity S (250 reactions), inventoried
Shipping Condition Room Temperature
No. of Reactions 250 Reactions
Volume 250 μL
Show More Show Less
What is the "alias" associated with the TaqMan miRNA assays?

An alias is the miRBAse ID for a given miRNA from an earlier version. Alias information is found in the Details section of the search results. The miRBase release version shown in parentheses represents when the alias miRBase ID was last listed.

Why is an assay for human named with the name of another species?

An assay for a human miRNA may have a lower species name because the target sequence was first introduced and published in miRBase for that species and only later found in human. For example, mmu-miR-124a was first introduced as a mouse miRNA. The human miRNA was introduced later.

What is the miRBAse accession number?

Accession numbers are unique identifiers assigned to both hairpin (e.g.: MI0000015) and mature (e.g.: MIMAT0000029) sequences. While miRBase names may change, the accession numbers are stable and remain associated with a specific sequence.

What is the miRBase ID?

The mirBase ID is the official miRBase name given to a mature miRNA sequence. There may be multiple miRBase IDs for a given mature miRNA sequence because many miRNAs are conserved across species (for example, several hundred human miRNAs have the identical sequence in common with the mouse species). The miRBase ID consist of a 3 letter species identifier, including the first letter of the genus and the first two letters of the species, followed by the expression “miR”, and then a numeric suffix, e.g.: hsa-miR-212. Since two distinct mature miRNAs can be derived from the different arms of the same stem-loop precursor, a -5p or -3p suffix specifies the particular arm of the stem from which they come, e.g.: hsa-miR-501-5p is derived from the 5' end of the stem, while hsa-miR-501-3p is derived from the 3' end. The miRNA gene and hairpin precursor locus name is given lower case: hsa-mir-212. If a mature miRNA is predicted to be expressed from more than one hairpin precursor, then a numeric suffix is added to the precursor name. For example, hsa-miR-101 is expressed from two precursor loci, hsa-mir-101-1 and hsa-mir-101-2. Closely related miRNAs are given lettered suffixes (hsa-miR-19a-3p and hsa-miR-19b-3p) and are expressed from similarly named precursors (hsa-mir-19a-3p and hsa-mir-19b-3p).

miRBase continues to re-annotate the miRNA sequences as more information becomes available. Updated versions of miRBase are released on a regular basis. At the time of print (June 2013), it was up to v20.

Is the TaqMan Advanced miRNA Assay (Cat. No. A25576) shipped at room temperature?

Yes. Like our other TaqMan assays, the miRNA assays are shipped at ambient temperatures and are stable for multiple days.

What is the reporter dye for my TaqMan Advanced miRNA Assay (Cat. No. A25576)?

All predesigned TaqMan Advanced MiRNA assays use FAM at the 5' end of the probe as a reporter.

Do you have any information about how the TaqMan Advanced miRNA assays perform with FFPE samples?

Yes, we have tested the advanced miRNA assays on FFPE samples. We have a collaboration with Dr. Judson at UCSF who has used the advanced assays to study miRNA expression in melanoma. Dr. Judson has presented his work in a webinar.

Have you validated the Stabilized Blood-to-CT Nucleic Acid Preparation Kit for qPCR, compatible with PAXgene Blood RNA Tubes (Cat. No. 4449082) with the TaqMan Advanced miRNA Assays?

We have not tested this kit with the TaqMan Advanced miRNA Assay. We have also not tested blood as sample to use directly with the TaqMan Advanced miRNA cDNA Synthesis Kit. Blood usually has a lot more impurities compared to serum or plasma, so it would be best to extract RNA from blood followed by the TaqMan Advanced cDNA synthesis reaction.

What is the amplicon size for TaqMan Advanced miRNA Assay (Cat. No. A25576)?

They are ~60bps.

What is the shelf-life of TaqMan Advanced miRNA Assays?

When stored at -20°C, TaqMan Advanced miRNA assays are stable for at least 5 years from the manufacturing date. The assays remain stable for at least 10 freeze-thaw cycles without compromising their functional performance.

How does TaqMan Advanced miRNA (Cat. No. A25576) work?

The TaqMan Advanced miRNA workflow comprises five steps. Steps 1-4 are completed using the TaqMan Advanced miRNA cDNA Synthesis kit (Cat. No. A28007). Please check the protocol in the TaqMan Advanced miRNA Assays User Guide. Step 5 is completed using the TaqMan Advanced miRNA Assays (Cat. No. A25576) together with the TaqMan Fast Advanced Master Mix (Cat. No. 4444556, sold separately). Briefly, the steps are as follows:

  • After isolation of total RNA, using a method that preserves small RNAs, Poly A polymerase is used to add a polyadenosine (polyA) tail on the 3’ end of all of the miRNAs in the sample.
  • In the next step, an oligonucleotide adaptor is ligated to the 5’ end of each of the miRNAs. This reaction is dependent on the presence of a 5’ phosphate, which is only present on mature miRNAs. Any exogenous controls or spike-ins must also have this 5’ phosphate in order to be accurately quantitated.
  • A Universal RT primer binds to the polyA tail of the miRNA to reverse transcribe the RNA into cDNA. This universal RT step will convert all of the mature miRNAs in the sample to cDNA.
  • Universal amplification (miR-Amp) reaction takes place, wherein, the universal forward and reverse primers amplify the cDNA for all miRNA targets in the sample. The miR-Amp step improves quantification of low expressing miRNAs and miRNAs collected from dilute samples such as body fluids.
  • miRNA-specific primers and TaqMan probe are used to quantitate each miRNA of interest using individual qPCR assays called TaqMan Advanced miRNA Assay. These assays work specifically with TaqMan Advanced miRNA and cannot be used with the original TaqMan Micro RNA Assay chemistry.

What dye and quencher are used by predesigned TaqMan Advanced miRNA assays/ and TaqMan MicroRNA Assays?

Both assays use, by default, FAM as a dye and NFQ-MGB as a quencher.

Do you offer an alternative for TaqMan Advanced miRNA cDNA Synthesis Kit (Cat. No. A28007)?

If you are performing your analysis with the TaqMan Advanced miRNA Assay (Cat. No. A25576), we do not offer an alternative and the cDNA has to be synthesized with that kit.

What run conditions should I use for the TaqMan® Advanced miRNA assays with the discontinued 7900HT Real-Time PCR System?

We recommend using the same thermal profile as listed for the 7500 and 7500 Fast systems (Table 8) in the TaqMan® Advanced miRNA Assays User Guide: https://assets.thermofisher.com/TFS-Assets%2FLSG%2Fmanuals%2F100027897_TaqManAdv_miRNA_Assays_UG.pdf

How can I order a template for miRNA exogenous control for a TaqMan advanced miRNA assay?

For TaqMan advanced miRNA assays, the templates for exogenous controls, such as ID: cel-miR-39-3p should be ordered separately as custom RNA oligos (https://www.thermofisher.com/order/catalog/en/US/adirect/lt?cmd=ConfigureRNASingleTube) using the mature sequences of the assays. Please use the following settings for ordering:

- Select siRNA from drop down menu
- For Sense Sequence, input mature miRNA target sequence of the assay - refer to page 9 of TaqMan Advanced miRNA Assays user guide (https://tools.thermofisher.com/content/sfs/manuals/100027897_TaqManAdv_miRNA_Assays_UG.pdf)
- Sense 5' modification: Phosphate
- 3' overhang: None
- Scale: 20 nmole
- Purity: Desalted

Do you recommend any spike-in control for the TaqMan Advanced miRNA Assay?

The non-human miRNAs listed below can be used as exogenous (spike-in) controls to monitor extraction efficiency or sample input amount for difficult samples (e.g. serum/plasma, or other biofluids). The final concentration of the spike-in control in your test sample should be 1-10 pM. Spike-in controls must be 5'-phosphorylated and can be ordered as custom RNA oligos at: https://www.thermofisher.com/order/catalog/en/US/adirect/lt?cmd=ConfigureRNASingleTube. TaqMan Advanced miRNA assays are available for a number of miRNAs that can be used as spike-in controls with human, mouse, and rat samples as listed below.

miRNA name, Target sequence, Assay ID
1. ath-miR159a, UUUGGAUUGAAGGGAGCUCUA, Assay ID: 478411_mir
2. cel-lin-4-5p, UCCCUGAGACCUCAAGUGUGA, Assay ID: 478289_mir
3. cel-miR-2-3p, UAUCACAGCCAGCUUUGAUGUGC, Assay ID: 478291_mir
4. cel-miR-238-3p, UUUGUACUCCGAUGCCAUUCAGA, Assay ID: 478292_mir
5. cel-miR-39-3p, UCACCGGGUGUAAAUCAGCUUG, Assay ID: 478293_mir
6. cel-miR-54-3p, UACCCGUAAUCUUCAUAAUCCGAG, Assay ID: 478410_mir
7. cel-miR-55-3p, UACCCGUAUAAGUUUCUGCUGAG, Assay ID: 478295_mir

Can I use U6 small nuclear RNA or snoRNA (RNU44 and RNU48) as an endogenous control for the TaqMan Advanced miRNA Assay?

With the exception of the U6 assay (assay ID: 001973), we do not recommend using any other small RNAs as endogenous controls for the TaqMan Advanced miRNA Assay. This is because these small RNAs lack the 5' phosphate that is required for addition of the ligation adaptor. We have several suggested human miRNA endogenous controls for the TaqMan Advanced miRNA assay and they can be found in the TaqMan Advanced miRNA Assays User Guide (https://tools.thermofisher.com/content/sfs/manuals/100027897_TaqManAdv_miRNA_Assays_UG.pdf).

What are the recommended endogenous controls for the TaqMan Advanced miRNA Assay?

The miRNAs listed below are known to be expressed at relatively constant levels across many different tissue types. These miRNAs may work as good endogenous controls for your sample and experimental condition. However, one should validate these controls since there is no universal miRNA that works across all sample types and experimental conditions. Please refer to our White Paper found here (https://www.thermofisher.com/content/dam/LifeTech/Documents/PDFs/miRNA-controls-WhitePaper.pdf)

1. hsa-miR-361-5p, Assay ID: 478056_mir
2. hsa-miR-186-5p, Assay ID: 477940_mir
3. hsa-miR-26a-5p, Assay ID: 477995_mir
4. hsa-miR-191-5p, Assay ID: 477952_mir
5. hsa-miR-451a, Assay ID: 478107_mir
6. hsa-miR-423-5p, Assay ID: 478090_mir
7. hsa-miR-320a, Assay ID: 478594_mir

Can I use TaqMan Gene Expression Master Mix or TaqMan Universal Master Mix for TaqMan Advanced miRNA Assay?

TaqMan Advanced miRNA Assay was validated with TaqMan Fast Advanced Master Mix (Cat. No, 4444557) and our claims are based on the results with it. There is no technical reason why TaqMan Gene Expression Master Mix and TaqMan Universal Master Mix wouldn't work. They may be slightly less sensitive and will take a longer time to run.

Which master mix do you recommend for TaqMan Advanced miRNA Assay?

We recommend using TaqMan Fast Advanced Master Mix, Cat. No. 4444557.

What is miR-Amp?

miR-Amp is a 30-minute universal amplification that uses 14 cycles of PCR to provide a 3-10 Ct improvement in sensitivity (depending on sample type). mir-Amp uses universal primers that recognize regions of the cDNA outside of the miRNA target sequence. These sequences are added onto all mature miRNAs in the sample during the cDNA synthesis workflow. The miR-Amp step does not introduce bias.

What is the main difference between first-generation TaqMan MicroRNA Assays and TaqMan Advanced miRNA Assays?

TaqMan Advanced miRNA Assay workflow has a universal RT and a universal pre-amplification step (miR-Amp). The first-generation TaqMan MicroRNA Assay workflow uses an miRNA-specific stem loop RT primer and has an optional pre-amplification step that is not built into the workflow but is sold separately. The main difference between these products is shown below:

TaqMan MicroRNA Assay:
- RT chemistry: Employs target-specific stem-loop primer during cDNA synthesis
- Pre-amplification: Not built into the workflow
- Throughput: Best for 1-10 targets
- Coverage: 205 species available; coverage for miRBase v21
- Format: Individual tubes, TaqMan array cards and plates, and OpenArray plates

TaqMan Advanced miRNA Assay:
- RT Chemistry: Employs a universal RT primer during cDNA synthesis
- Pre-amplification: Built into the workflow
- Throughput: Best for > 10 targets
- Coverage: Only human species is currently available; coverage for miRBase v21
- Format: Individual tubes, TaqMan array cards and plates, and OpenArray plates


For Research Use Only. Not for use in diagnostic procedures.