missing translation for 'onlineSavingsMsg'
Learn More

Invitrogen™ GeneRacer™ Kit with SuperScript™ III RT and Zero Blunt™ TOPO™ PCR Cloning Kit for Sequencing

Catalog No. L150202
Encompass
Change view
Click to view available options
Quantity:
1 Kit
1 product options available for selection
Product selection table with 1 available options. Use arrow keys to navigate and Enter or Space to select.
Catalog No. Quantity
L150202 1 Kit
Use arrow keys to navigate between rows. Press Enter or Space to select a product option. 1 options available.
1 options
Catalog No. L150202 Supplier Invitrogen™ Supplier No. L150202
Only null left

Advanced RACE (rapid amplification of cDNA ends) technique that improves efficiency of amplifying full-length 5' and 3' cDNA ends

The GeneRacer Kit is available with SuperScriptIII Reverse Transcriptase (RT) for improved amplification of the full-length 5' end from long and complex mRNA. The RNase H portion of SuperScriptIII RT has been mutated to avoid cleaving mRNA during cDNA synthesis. This increases the size and yield of cDNA. SuperScriptIII RT is more thermostable than wild-type RTs. This enables reverse transcription at higher temperatures, relaxing secondary structure of complex templates, and allowing cDNA synthesis to go to completion.

  • Generates cDNA from transcripts at least 10 kb in length
  • Obtain the full-length 5' end of rare transcripts at fewer than 30 copies per cell
  • Clone the full-length 5' and 3' ends to construct complete cDNA sequence

Cloning, PCR and Real-Time PCR, Reverse Transcription, cDNA Libraries and Library Construction

Specifications

Bacterial or Yeast Strain TOP10
Cloning Method Zero Blunt TOPO
Content And Storage Each GeneRacer™ Kit contains the GeneRacer™ box, an RT box, S.N.A.P.™ columns, and a TOPO™ Cloning Kit. The GeneRacer™ and the RT box contain sufficient reagents for five cDNA reactions plus one control reaction and primers for 50 PCR reactions. Included in the GeneRacer™ box are the enzymes CIP, TAP, T4 RNA ligase, and their buffers, the GeneRacer™ RNA Oligo (pre-aliquotted and lyophilized), GeneRacer™ Primers and Nested Primers, RNaseOUT™ Recombinant Ribonuclease Inhibitor, phenol/chloroform, mussel glycogen, sterile water, and controls. Store at -20°C. The SuperScript™ III RT box includes SuperScript™ III RT, 5X first-strand buffer, DTT, RNase H, random primers, the GeneRacer™ Oligo dT Primer, and dNTP mix. Store at -20°C. The Cloned AMV RT box includes cloned AMV RT, 5X RT buffer, random primers, the GeneRacer™ Oligo dT Primer, and dNTP mix. Store at -80°C. A separate bag contains ten S.N.A.P.™ gel purification columns for gel-purifying PCR products. Store at room temperature. The 10-reaction TOPO™ Cloning Kit for Sequencing contains two boxes. Store the TOPO™ Cloning box at -20°C. Store the competent E. coli box at -70°C. All reagents are guaranteed stable for 6 months when properly stored.
Format Kit
For Use With (Application) Reverse Transcription
Includes Each GeneRacer Kit contains the GeneRacer box, an RT box, S.N.A.P. columns, and a TOPO Cloning Kit. The GeneRacer and the RT box contain sufficient reagents for five cDNA reactions plus one control reaction and primers for 50 PCR reactions. Included in the GeneRacer box are the enzymes CIP, TAP, T4 RNA ligase, and their buffers, the GeneRacer RNA Oligo (pre-aliquotted and lyophilized), GeneRacer Primers and Nested Primers, RNaseOUT Recombinant Ribonuclease Inhibitor, phenol/chloroform, mussel glycogen, sterile water, and controls. The SuperScript III RT box includes SuperScript III RT, 5X first-strand buffer, DTT, RNase H, random primers, the GeneRacer Oligo dT Primer, and dNTP mix. The Cloned AMV RT box includes cloned AMV RT, 5X RT buffer, random primers, the GeneRacer Oligo dT Primer, and dNTP mix. A separate bag contains ten S.N.A.P. gel purification columns for gel-purifying PCR products. Store at room temperature. The 10-reaction TOPO Cloning Kit for Sequencing contains two boxes. Competent E. coli .
Product Line GeneRacer, SuperScript, TOPO, Zero Blunt
Product Type Cloning Kit
Quantity 1 Kit
Vector pCR4Blunt-TOPO
I'm getting PCR products from my 5' RACE, but they are not full length. What should I do?

The GeneRacer method is designed to ensure that only full-length messages are ligated to the GeneRacer RNA Oligo and PCR amplified after cDNA synthesis. It is highly recommended that you clone your RACE products and analyze at least 10-12 colonies to ensure that you isolate the longest message. Many genes do not have only one set of transcription start sites but rather multiple transcription start sites spanning sometimes just a few or other times a hundred or even more bases. Cloning of the RACE products and analyzing multiple colonies ensues that you detect the diversity of the heterogeneous transcription start sites of your gene. It is also possible that you might obtain PCR products that may not represent the full-length message for your gene. PCR products that do not represent full-length message may be obtained because:

-RNA degradation after the CIP reaction creates new truncated substrates with a 5' phosphate for ligation to the GeneRacer RNA Oligo. Be sure to take precautions to ensure that the RNA is not degraded.
-CIP dephosphorylation was incomplete. Increase the amount of CIP in the reaction or decrease the amount of RNA.
-PCR yielded a PCR artifact and not true ligation product. Optimize your PCR using the suggestions described above.

I'm seeing RACE PCR artifacts in my GeneRacer experiment. What am I doing wrong?

RACE PCR artifacts or nonspecific PCR bands can result from one or more of the following:

-Nonspecific binding of GSPs to other cDNAs resulting in the amplification of unrelated products as well as desired products.
-Nonspecific binding of GeneRacer primers to cDNA resulting in PCR products with GeneRacer primer sequence on both ends of the PCR product.
-RNA degradation.
-Contamination of PCR tubes or reagents.
Note: Artifacts usually result from less than optimal PCR conditions and can be identified in negative control PCR.

I'm getting unexpected bands after electrophoretic analysis of my amplified RT-PCR products. Can you please offer some suggestions?

Please see the following causes and suggestions:
Contamination by genomic DNA or an unexpected splice variant - Pretreat RNA with DNase I, amplification grade (Cat. No 18068015).
Design primers that anneal to sequences in exons on both sides of an intron or at the exon/exon boundary of the mRNA to differentiate between amplified cDNA and potential contaminating genomic DNA.
To test if products were derived from DNA, perform a minus RT control.
Nonspecific annealing of primers - Vary the PCR annealing conditions.
Use a hot-start PCR polymerase.
Optimize magnesium concentration for each template and primer combination.
Primers formed dimers - Design primers without complementary sequences at the 3' ends.

I'm getting no bands after electrophoretic analysis of my amplified RT-PCR products. Can you please offer some tips?

Please see the following causes and suggestions:

Procedural error in first-strand cDNA synthesis - Use high-quality RNA as a control to verify the efficiency of the first-strand reaction.
RNase contamination - Add control RNA to sample to determine if RNase is present in the first-strand reaction. Use an RNase inhibitor in the first-strand reaction.
Polysaccharide co-precipitation of RNA - Precipitate RNA with lithium chloride to remove polysaccharides, as described in Sambrook et al.
Target mRNA contains strong transcriptional pauses - Use random hexamers instead of oligo(dT) in the first-strand reaction, increase the temperature, and use PCR primers closer to the 3' terminus of the target cDNA.
Too little first-strand product was used in PCR - Use up to 10% of first-strand reaction per 50 mL PCR.
Gene-specific primer was used for first-strand synthesis - Try another set of GSP or switch to oligo(dT). Make sure the GSP is the antisense of the sequence.
Inhibitors of RT present - Remove inhibitors by ethanol precipitation of mRNA preparation before the first-strand reaction. Include a 70% (v/v) ethanol wash of the mRNA pellet. Note: inhibitors of RT include SDS, EDTA, guanidinium salts, formamide, sodium pyrophosphate, and spermidine.
RNA has been damaged or degraded - Ensure that high-quality, intact RNA is being used.
Annealing temperature is too high - Decrease temperature as necessary and/or use touchdown PCR.

How does the 3' RACE system work?

3' RACE takes advantage of the natural poly(A) tail found in mRNA as a generic priming site for PCR. In this procedure, mRNAs are converted into cDNA using reverse transcriptase (RT) and an oligo-dT adapter primer. Specific cDNA is then amplified by PCR using a gene-specific primer (GSP) that anneals to a region of known exon sequences and an adapter primer that targets the poly(A) tail region. This permits the capture of unknown 3'-mRNA sequences that lie between the exon and the poly(A) tail.

What are some ways for me to optimize my RACE reaction?

Here are our suggestions to optimize your RACE reaction:

-Use high-quality, intact RNA
-Use an RNA sample in which your gene is expressed at high levels
-Do not exceed the recommended amount of input material in each step
-Optimize annealing temperatures for PCR
-Include recommended controls

Why does my RACE reaction show more than one band?

Alternative splicing, an alternative polyadenylation site, and alternative start sites can yield legitimate multiple bands. Sequencing will help to resolve any uncertainty.

How do I know if my bands from RACE are real?

If the reaction gives a specific product and the control reaction does not, your band is probably real. The only way to be sure is to sequence the product.

How do I design my gene-specific primers for my GeneRacer experiment?

If you are performing either 5' or 3' RACE, you will need one gene-specific primer and if you are performing both 5' and 3' RACE, you would need two gene-specific primers. The primers should follow the rules stated below:

-50-70% GC content to obtain a high annealing temp (>72 degrees C)
-23-28 nucleotides in length to increase specificity of binding
-Low-GC content at 3' ends to minimize extension by DNA polymerase at non-target sites (no more than two G or C residues in the last five bases)
-No self-complementary sequences within the primer or no sequence complementary to the primers supplied in the kit, especially at the 3' end
-Annealing temperature greater than 72 degrees C—using primers with a high annealing temperature will help to improve specificity of your PCR

How can I check the integrity of my starting RNA sample for RACE?

To check the RNA for integrity, analyze 500 ng of your RNA by agarose/ethidium bromide gel electrophoresis. You may use a regular 1% agarose gel or a denaturing agarose gel. For total RNA you should see the 28S and 18S rRNA bands. mRNA will appear as a smear from 0.5 to 12 kb. The 28S band should be twice the intensity of the 18S band. If you do not load enough RNA, the 28S band may appear to be diffuse. If you are using a denaturing gel, the rRNA bands should appear very clear and sharp. The 28S band should run at 4.5 kb and the 18S band should run at 1.9 kb.

What is RACE and what does it stand for?

RACE stands for Rapid Amplification of cDNA Ends. It is a method used to discover the 5' and/or 3' end of full-length transcripts. If partial sequence is known for a transcript of interest, RACE can help to elucidate the full ORF, 5' UTR, and 3' UTR sequences.

I'm seeing a lot of vector-only colonies when I try to perform a negative control reaction using vector only (no insert) for a TOPO reaction. Is my TOPO vector re-ligating?

Using the vector only for transformation is not a recommended negative control. The process of TOPO-adaptation is not a 100% process, therefore, there will be “vector only” present in your mix, and colonies will be obtained.

I'm trying to clone in my phosphorylated PCR product into a TOPO vector, and I'm getting no colonies. However, when I clone the same product into a TA vector, everything works perfectly. Why is this?

Phosphorylated products can be TA cloned but not TOPO cloned. This is because the necessary phosphate group is contained within the topoisomerase-DNA intermediate complex of the vector. TOPO vectors have a 3' phosphate to which topoisomerase is covalently bound and a 5' phosphate. Non-TOPO linear vectors (TA and Blunt) have a 3' OH and a 5' phosphate. Phosphorylated products should be phosphatased (CIP) before TOPO cloning.

I'm able to get a lot of colonies, however, none contain my insert of interest. What should I do?

You may be cloning in an artifact. TA and TOPO Cloning are very efficient for small fragments (< 100 bp) present in certain PCR reactions. Gel-purify your PCR product using either a silica-based DNA purification system or electroelution. Be sure that all solutions are free of nucleases (avoid communal ethidium bromide baths, for example.)

A majority of colonies are blue or light blue, with very few white colonies. What should I do?

There could be a few possibilities for this:

- The insert does not interrupt the reading frame of the lacZ gene. If you have a small insert (< 500 bp), you may have light blue colonies. Analyze some of these blue colonies as they may contain insert.
- A polymerase that does not add 3' A-overhangs was used. If you used a proofreading enzyme, you will need to do a post-reaction treatment with Taq polymerase to add the 3' A-overhangs.
- PCR products were gel-purified before ligation. Gel purification can remove the single 3' A- overhangs. Otherwise, optimization of your PCR can be performed so that you can go directly from PCR to cloning.
- The PCR products were stored for a long period of time before ligation reaction. Use fresh PCR products. Efficiencies are reduced after as little as 1 day of storage.
- Too much of the amplification reaction was added to the ligation. The high salt content of PCR can inhibit ligation. Use no more than 2-3 µl of the PCR mixture in the ligation reaction.
- The molar ratio of vector:insert in the ligation reaction may be incorrect. Estimate the concentration of the PCR product. Set up the ligation reaction with a 1:1 or 1:3 vector:insert molar ratio.
On a typical plate there are a few white colonies which do not contain insert. These are usually larger than the other colonies and are due to a deletion of a portion of the plasmid sequence by a rare recombination event (usually from the polylinker to a site in the F1 origin). To find a colony with an insert it is best to pick clones of a variety of color and pattern for analysis. Often an insert will generate two distinct patterns according to its orientation.

I'm getting no colonies after transformation. What should I do?

No colonies may occur due to the following problems:

Bacteria were not competent. Use the pUC18 vector included with the One Shot module to check the transformation efficiency of the cells.
- Incorrect concentration of antibiotic on plates, or the plates are too old. Use 100 µg/mL of ampicillin or 50 µg/mL kanamycin. Be sure ampicillin plates are fresh (< 1 month old).
- The product was phosphorylated (TOPO cloning only). Phosphorylated products can be TA-cloned but not TOPO-cloned. This is because the necessary phosphate group is contained within the topoisomerase-DNA intermediate complex of the vector. The TOPO vector has a 3' phosphate to which topoisomerase is covalently bound and a 5' phosphate. The non- TOPO vectors (TA and Blunt) have a 3' OH and a 5' phosphate. Phosphorylated products should be phosphatased (CIP) before TOPO-cloning.

I'm getting low cloning efficiency with my TOPO cloning reactions. What should I do?

Please consider the following possible causes:
- pH > 9: Check the pH of the PCR amplification reaction and adjust with 1 M Tris-HCl, pH 8.
- Excess (or overly dilute) PCR product: Reduce (or concentrate) the amount of PCR product.
- Incomplete extension during PCR: Be sure to include a final extension step of 7 to 30 minutes during PCR. Longer PCR products will need a longer extension time.
- Cloning large inserts (>1 kb): Try one or all of the following suggestions: Increase amount of insert. Incubate the TOPO cloning reaction longer. Gel-purify the insert using either a silica-based DNA purification system (e.g., PureLink system) or electroelution. Be sure that all solutions are free of nucleases (avoid communal ethidium bromide baths, for example.)
- PCR product does not contain sufficient 3' A-overhangs even though you used Taq polymerase: Increase the final extension time to ensure all 3' ends are adenylated. Taq polymerase is less efficient at adding a nontemplate 3' A next to another A. Taq is most efficient at adding a nontemplate 3' A next to a C. You may have to redesign your primers so that they contain a 5' G instead of a 5´ T.

I'm getting very few colonies after transformation of my TOPO cloning reaction. How can I increase the number of primary colonies?

Please try the suggestions below to increase the number of colonies.
- Longer incubation of the TOPO cloning reaction at room temperature, provided that the 6X Salt solution is added to the reaction.
- Electroporation can give significant increases in colony numbers; often 10-20 fold higher. However, if doing electroporation, it is important that the TOPO reaction mix contains diluted Salt solution or, for best results, precipitated prior to transformation. For high primary transformants by electroporation it is recommended to:
- Add 100 µL double diH2O to the 6 µL TOPO reaction and incubate 10 more minutes at 37 degrees C.
- Precipitate by adding 10 µL 3 M Na-Acetate, 2 µL 20 µg/µL glycogen, 300 µL 100% ethanol. Place on dry ice or –80 degrees C for 20 min, spin at top speed in a microcentrifuge at 4 degrees C for 15 min. Wash pellet with 800 µL 80% ethanol, spin at top speed for 10 min, pour off ethanol, spin 1 min, and remove remaining ethanol without disturbing pellet. Dry pellet (air-dry or speed-vac).
- Resuspend pellet in 10 µL ddH2O and electroporate 3.3 µL of resuspended DNA according to a normal electroporation protocol. This electroporation protocol can yield up to 20 fold more colonies than chemical transformation of an equivalent TOPO-reaction. The addition of the 100 µL ddH2O followed by 10 mins incubation is not absolutely necessary, but it sufficiently dilutes the reaction and may help inactivate topoisomerase so that it is more easily electroporated.

I'm planning on cloning a 1kb fragment for sequencing and want to minimize the amount of vector sequence in my data. Which of your vectors should I use?

We would suggest using our TOPO TA cloning kit for sequencing, which contains the pCR 4 TOPO vector, or our Zero Blunt TOPO PCR cloning kit for sequencing, which contains the pCR4Blunt-TOPO vector.

I have a blunt-ended restriction product cut from another cloning vector. Can I insert this into a Zero Blunt TOPO vector?

Yes, though you will need to treat it with calf intestinal phosphatase (CIP) to get rid of the 5' phosphate group for TOPO Cloning.

Which PCR polymerases do you recommend for TA/Blunt/D-TOPO cloning and why?

TA Cloning:
- This cloning method was designed for use with pure Taq polymerases (native, recombinant, hot start); however, High Fidelity or Taq blends generally work well with TA cloning. A 10:1 or 15:1 ratio of Taq to proofreader polymerase will still generate enough 3' A overhangs for TA cloning.
- Recommended polymerases include Platinum Taq, Accuprime Taq, Platinum or Accuprime Taq High Fidelity, AmpliTaq, AmpliTaq Gold, or AmpliTaq Gold 360.

Blunt cloning:
- Use a proofreading enzyme such as Platinum SuperFi DNA Polymerase.

Directional TOPO cloning:
- Platinum SuperFi DNA Polymerase works well.

How can I prevent smearing when using GeneRacer Kit?

Several factors are important for the best results.

(1) The key factor for success is the quality of the RNA. RNA degradation is the most likely reason for failure to obtain a correct RACE product. We strongly recommend that you analyze a sample of your RNA on an agarose gel before starting to confirm RNA integrity. The use of RNaseOUT RNase inhibitor ensures RNA stability during various enzymatic reactions. If you are concerned about RNA stability, you may check the stability of the RNA after each enzymatic reaction (CIP, TAP, and ligation reaction) using agarose gel electrophoresis. Resuspend the RNA in DEPC water after enzymatic treatment in an appropriate volume (see pages 7, 9 and 11 of GeneRacer kit manual) and check 1 µL on an agarose gel. Compare with the same amount of untreated RNA to check for degradation.

(2) RACE PCR artifacts or non-specific PCR bands can result from one or more of the following:
-Non-specific binding of GSPs to other cDNAs resulting in the amplification of unrelated products as well as desired products.
-Non-specific binding of GeneRacer primers to cDNA resulting in PCR products with GeneRacer primer sequence on one end.
-RNA degradation.
-Contamination of PCR tubes or reagents.

Note: Artifacts usually result from less-than-optimal PCR conditions and can be identified in negative control PCR.

(3) If a smear in GeneRacer 5' primer negative control is visible, then we recommend the following:
-Use a different 5' primer, called the GeneRacer 5' primer. It is homologous to the slightly different site at the RNA oligo but it generally gives less background compared to the original 5' primer. Here is the sequence of the GeneRacer 5' primer: 5' GCACGAGGACACTGACATGGACTGA This primer can be synthesized and used in the 5' RACE PCR instead of the original 5' primer. It should reduce the background in RACE PCR.

(4) If you see smears when performing the negative control using 5' primer, the other negative controls (no template, GSP with template) were fine, and all reactions had the same PCR conditions, then:
-If there is background when using the 5' primer and template than you should subtract those bands/smear from the actual RACE reaction discarding it so that not to confuse with the real RACE bands. The smear in that negative control will always be there because every cDNA has the binding site for that primer. So there should not be any major concern about the smear. If the actual RACE PCR works then the RACE band would outweigh the smear background.

What PCR enzyme would you recommend for use with the Directional TOPO Cloning Kits?

For the Directional TOPO Cloning Vectors, a PCR product must be generated by a proofreading enzyme to create a blunt product. Pfx50 or Accuprime Pfx and Accuprime Pfx Supermix from Thermo Fisher Scientific are recommended for use.

When cloning a Pfx-amplified PCR product, the insert to vector ratio is an important consideration. The PCR product generally needs to be diluted since Pfx generates a high concentration of product and using too much insert DNA can hamper the TOPO reaction. A 1:1 molar ratio of vector to insert (or about 2-10ng of insert) is recommended.

Can I use the pCR-Blunt or pCR-Blunt-TOPO vector to clone PCR products amplified with Taq DNA polymerase?

No you cannot use pCR-Blunt or pCR-Blunt-TOPO vector to clone PCR products amplified with Taq DNA polymerase. The pCR-Blunt vector is prepared with blunt ends to accept blunt-ended fragments. Due to the terminal transferase activity of Taq DNA polymerase, PCR products amplified with this enzyme have 3'-A overhangs. In order to clone these products into pCR-Blunt, you would need to polish the ends to make them blunt (which usually is not an efficient process). Our TA Cloning Kits or TOPO TA Cloning kits are a better choice for cloning Taq-generated PCR products. TA Cloning kits include a linearized vector with 3'-T overhangs for efficient ligation of Taq-generated PCR products without additional manipulation.

What are the melting temperatures for the M13 Forward (-20) and M13 Reverse primers in the TOPO Cloning and Zero Blunt Kits?

Assuming that the primer is at a 50 nM final concentration and 50 mM final salt concentration, the melting temperatures are: M13 Forward (-20) Primer = 52.7 and the M13 Reverse Primer = 45.3. For use in the control PCR reaction we recommend using an annealing temperature of 56C.

What is the role of Calf Intestinal Phosphatase (CIP) enzyme in your GeneRacer kit?

CIP will remove the 5' phosphates from DNA or RNA, acting on both protruding or recessed phosphates. In the GeneRacer kit, it is used to eliminate any background RNA, including non-mRNA or truncated mRNA that does not have the 5' Methyl Cap structure. CIP will not digest the Methyl Cap structure, allowing these capped transcripts to be further processed in the GeneRacer protocol and only allowing full length transcripts to be amplified by 5' RACE.


For Research Use Only. Not for use in diagnostic procedures.