Invitrogen™ PCR Cloning System with Gateway™ Technology with pDONR™/Zeo & OmniMAX™2 Competent Cells

– Check whether the reaction was transformed into an E.coli strain containing the F' episome and the ccdA gene – use an E.coli strain that does not contain the F' episome, e.g. DH10B, TOP10.
– Deletion (full or partial) of the ccdB gene – propagate in media with 50-100 mg/mL ampicillin and 15-30 µg/mL chloramphenicol.
– Contamination from another resistant strain.
– Check whether proper amount of DNA was used in the reaction.

Typically when both large and small colonies are produced following BP recombination, we recommend screening several of both of the small and large colony types by analytical restriction digest, PCR with gene specific primers, or by sequencing to determine what you have and decide on the best course forward. If one of the colonies you analyze contains your desired entry clone, then you may proceed with this entry clone to an LR reaction to produce your desired expression clone.

There are several possible causes of this issue:

– Plasmid was lost during culture due to large size or toxicity – To improve results next time you perform a BP reaction with a tricky insert, you may try incubating your transformation plate at 30 degrees C and/or use Stbl2 E.coli to stabilize the plasmid. We also recommend performing the BP reaction positive control pEXP7-Tet alongside your BP cloning reaction of interest; the results of that control reaction will let you know whether the large and small colony phenotype is specific to your insert of interest.

– Deletions (full or partial) or point mutations in the ccdB gene – A negative BP reaction control (with no BP clonase added) should not produce any colonies – If a no BP clonase negative control produces colonies, then the ccdB/chlorophenicol cassette is compromised and we recommend to obtain a new pDONR vector.br/>
– Background on antibiotic selection plate due to contamination or expired antibiotic – If you run a no plasmid added transformation negative control plate, then this plate should not produce any colonies. Colonies on transformation negative control plate suggests contamination or need to make fresh plates.

– Check the competent cells with pUC19 transformation.
– Increase the amount plated.

– Increase the incubation time up to 18 hours.
– Make sure to treat reactions with proteinase K before transformation.
– Check whether the correct antibiotic was used for selection.
– Check whether the att site sequences are correct.
– Check whether the correct Clonase enzyme was used and whether it was functional.
– Check whether the recommended amount of DNA was used in the reaction.
– Check primer design and try gel/PEG purifying the attB-PCR product.
– If the attB-PCR product or linear attB Expression clone is too long (>5 kb), incubate the BP reaction overnight.

You may continue, but the recombination efficiency will drop by approximately 10 fold.

For the most efficient BP reaction, it is best to not have attB sites in molar excess of attP sites. The standard BP Reaction (20 µL) uses 300 ng (no more than 500 ng) of pDONR vector and 30-300 ng attB-flanked PCR product or Expression Clone for 1 hour at 25 degrees C. Using too much of the Donor vector in the reaction tube will inhibit the BP reaction and also result in intact donor vector being co-transformed with the Entry Clones. This will reduce the number of colonies on the plate by killing the transformed E. coli due to the presence of the ccdB gene. Longer incubation times of up to 24 hours can be used to convert a higher percentage of starting attB-DNA to product. For PCR products > 4 kb, the number of colonies obtained per fmol of PCR DNA added decreases with increasing size. Thus, for larger PCR products, it is recommended to increase the amount of DNA to at least 100 fmol of PCR product per 20 µL reaction, and using incubations longer than one hour (e.g., 6 hours or overnight to 24 hours). The largest PCR-amplified DNA cloned in-house was 10.1 kb. Increasing the incubation to 4-6 hours will typically increase colony output 2-3 fold and 16-24 hours will typically increase colony output 5-10 fold.

The backbones of the pDONR221 and pDONR/Zeo vectors are exactly the same except for the antibiotic resistance marker. pDONR221 has the kanamycin antibiotic resistance marker, while pDONR/Zeo has the zeocin resistance marker.

pDONR201 and pDONR207 can be used, but they replicate less efficiently than the Donor vectors we offer, pDONR221 and pDONR/Zeo, even though both pDONR201 and pDONR207 contain the pUC ori. This results in lower plasmid yields. With pDONR221, plasmid yields are in the range of 0.5 - 1.0 µg of DNA per mL of culture.

The smallest insert that has been successfully cloned into a pDONR vector in-house is 70 bp and the largest is 12 kb. Although successful cloning of small inserts from 50-200 bp is sequence-dependent, literature suggests that very small inserts (~30 bp) will not clone efficiently (Cheo et al., Genome Research, 14:2111-2120). For inserts larger than 70 bp, the efficiency of cloning decreases as the insert size increases. For inserts larger than 5 kb, we recommend an overnight incubation of the BP cloning reaction.

There is no theoretical limit to insert size for a BP reaction with a pDONR vector. Maximum size tested in-house is 12 kb. TOPO vectors are more sensitive to insert size and 3-5 kb is the upper limit for decent cloning efficiency.

After generating your attB-PCR product, we recommend purifying it to remove PCR buffer, unincorporated dNTPs, attB primers, and any attB primer-dimers. Primers and primer-dimers can recombine efficiently with the Donor vector in the BP reaction and may increase background after transformation into E. coli, whereas leftover PCR buffer may inhibit the BP reaction. Standard PCR product purification protocols using phenol/chloroform extraction followed by ammonium acetate and ethanol or isopropanol precipitation are not recommended for purification of the attB-PCR product as these protocols generally have exclusion limits of less than 100 bp and do not efficiently remove large primer-dimer products. We recommend a PEG purification protocol (see page 17 of the Gateway Technology with Clonase II manual). If you use the above protocol and your attB-PCR product is still not suitably purified, you may further gel-purify the product. We recommend using the PureLink Quick Gel Extraction kit.

Please see Page 13 of the “Gateway Technology with Clonase II” manual (http://tools.thermofisher.com/content/sfs/manuals/gateway_clonaseii_man.pdf) for the information.

Check the genotype of the cell strain you are using. Our Gateway destination vectors typically contain a ccdB cassette, which, if uninterrupted, will inhibit E. coli growth. Therefore, un-cloned vectors should be propagated in a ccdB survival cell strain, such as our ccdB Survival 2 T1R competent cells.

LR Clonase II Plus contains an optimized formulation of recombination enzymes for use in MultiSite Gateway LR reactions. LR Clonase and LR Clonase II enzyme mixes are not recommended for MultiSite Gateway LR recombination reactions, but LR Clonase II Plus is compatible with both multi-site and single-site LR recombination reactions.

When the LR reaction is complete, the reaction is stopped with Proteinase K and transformed into E. coli resulting in an expression clone containing a gene of interest. A typical LR reaction followed by Proteinase K treatment yields about 35,000 to 150,000 colonies per 20ul reaction. Without the Proteinase K treatment, up to a 10 fold reduction in the number of colonies can be observed. Despite this reduction, there are often still enough colonies containing the gene of interest to proceed with your experiment, so the Proteinase K step can be left out after the LR reaction is complete if necessary.

For best results, DNA used in electroporation must have a very low ionic strength and a high resistance. A high-salt DNA sample may be purified by either ethanol precipitation or dialysis.

The following suggested protocols are for ligation reactions of 20ul. The volumes may be adjusted to suit the amount being prepared.

Purifying DNA by Precipitation: Add 5 to 10 ug of tRNA to a 20ul ligation reaction. Adjust the solution to 2.5 M in ammonium acetate using a 7.5 M ammonium acetate stock solution. Mix well. Add two volumes of 100 % ethanol. Centrifuge at 12,000 x g for 15 min at 4C. Remove the supernatant with a micropipet. Wash the pellet with 60ul of 70% ethanol. Centrifuge at 12,000 x g for 15 min at room temperature. Remove the supernatant with a micropipet. Air dry the pellet. Resuspend the DNA in 0.5X TE buffer [5 mM Tris-HCl, 0.5 mM EDTA (pH 7.5)] to a concentration of 10 ng/ul of DNA. Use 1 ul per transformation of 20 ul of cell suspension.

Purifying DNA by Microdialysis: Float a Millipore filter, type VS 0.025 um, on a pool of 0.5X TE buffer (or 10% glycerol) in a small plastic container. Place 20ul of the DNA solution as a drop on top of the filter. Incubate at room temperature for several hours. Withdraw the DNA drop from the filter and place it in a polypropylene microcentrifuge tube. Use 1ul of this DNA for each electrotransformation reaction.

In most cases, there will not be enough pENTR vector DNA present to go directly from TOPO cloning into an LR reaction. You need between 100-300 ng of pENTR vector for an efficient LR reaction, and miniprep of a colony from the TOPO transformation is necessary to obtain that much DNA. However, if you want to try it, here are some recommendations for attempting to go straight into LR reactions from the TOPO reaction using pENTR/D, or SD TOPO, or pCR8/GW/TOPO vectors:

1. Heat inactivate the topoisomerase after the TOPO cloning reaction by incubating the reaction at 85 degrees C for 15 minutes.
2. Use the entire reaction (6 µL) in the LR clonase reaction. No purification steps are necessary.
3. Divide the completed LR reaction into 4 tubes and carry out transformations with each tube. You cannot transform entire 20 µL reaction in one transformation, and we have not tried ethanol precipitation and then a single transformation.

When attempting this protocol, we observed very low efficiencies (~10 colonies/plate). So just be aware that while technically possible, going directly into an LR reaction from a TOPO reaction is very inefficient and will result in a very low colony number, if any at all.

To have an N-terminal tag, the gene of interest must be in the correct reading frame when using non-TOPO adapted Gateway entry vectors. All TOPO adapted Gateway Entry vectors will automatically put the insert into the correct reading frame, and to add the N-terminal tag you simply recombine with a destination vector that has N-terminal tag.

To attach a C-terminal tag to your gene of interest, the insert must lack its stop codon, and be in the correct reading frame for compatibility with our C-terminal tagged destination vectors. Again, TOPO adapted Gateway Entry vectors will automatically put the insert into the correct reading frame. If you do not want the C-terminal tag to be expressed, simply include a stop codon at the end of the insert that is in frame with the initial ATG.

Generally, you need to choose a destination vector before you design and clone your insert into the Entry vector. This will determine whether you need to include an initiating ATG or stop codon with your insert.

No, not directly. The attB-PCR product must first be cloned, via a BP Clonase reaction, into a pDONR vector which creates an "Entry Clone" with attL sites. This clone can then be recombined, via an LR Clonase reaction, with a Destination vector containing attR sites. However, It is possible to perform both of these reactions in one step using the "One-Tube Protocol" described in the manual entitled "Gateway Technology with Clonase II".

Yes, this can be done using the Multisite Gateway Technology. MultiSite Gateway Pro Technology enables you to efficiently and conveniently assemble multiple DNA fragments - including genes of interest, promoters, and IRES sequences - in the desired order and orientation into a Gateway Expression vector. Using specifically designed att sites for recombinational cloning, you can clone two, three, or four DNA fragments into any Gateway Destination vector containing attR1 and attR2 sites. The resulting expression clone is ready for downstream expression and analysis applications.

For the BP reaction, approximately 5-10% of the starting material is converted into product. For the LR reaction, approximately 30% of the starting material is converted into product.

The core region of the att sites contains the recognition sequence for the restriction enzyme BsrGI. Provided there are no BsrGI sites in the insert, this enzyme can be used to excise the full gene from most Gateway plasmids. The BsrGI recognition site is 5'-TGTACA and is found in both att sites flanking the insertion site.

If a different restriction site is desired, the appropriate sequence should be incorporated into your insert by PCR.

We do have an alternative method called the "attB Adapter PCR" Protocol in which you make your gene specific primer with only 12 additional attB bases and use attB universal adapter primers. This protocol allows for shorter primers to amplify attB-PCR products by utilizing four primers instead of the usual two in a PCR reaction. You can find the sequence of these primers in the protocol on page 45 of the "Gateway Technology with Clonase II" manual.

There is a protocol in which all 4 primers mentioned above are in a single PCR reaction. You can find this protocol at in the following article: Quest vol. 1, Issue 2, 2004. https://www.thermofisher.com/us/en/home/references/newsletters-and-journals/quest-archive.reg.in.html. The best ratio of the first gene-specific and the second attB primers was 1:10.

We do not offer pre-made primers, but we can recommend the following sequences that can be ordered as custom primers for sequencing of pDONR201:
Forward primer, proximal to attL1: 5'- TCGCGTTAACGCTAGCATGGATCTC
Reverse primer, proximal to attL2: 5'-GTAACATCAGAGATTTTGAGACAC

1. Yeast two-hybrid protein-protein interaction studies Walhout AJ, Sordella R, Lu X, Hartley JL, Temple GF, Brasch MA, Thierry-Mieg N, Vidal M.

2. Protein Interaction Mapping in C. elegans Using Proteins Involved in Vulval Development. Science Jan 7th 2000; 287(5450), 116-122 Davy, A. et al.

3. A protein-protein interaction map of the Caenorhabditis elegans 26S proteosome. EMBO Reports (2001) 2 (9), p. 821-828. Walhout, A.J.M. and Vidal, M. (2001).

4. High-throughput Yeast Two-Hybrid Assays for Large-Scale Protein Interaction mapping. Methods: A Companion to Methods in Enzymology 24(3), pp.297-306

5. Large Scale Analysis of Protein Complexes Gavin, AC et al. Functional Organization of the Yeast Proteome by Systematic Analysis of Protein Complexes. Nature Jan 10th 2002, 415, p. 141-147.

6. Systematic subcellular localisation of proteins Simpson, J.C., Wellenreuther, R., Poustka, A., Pepperkok, R. and Wiemann, S.

7. Systematic subcellular localization of novel proteins identified by large-scale cDNA sequencing. EMBO Reports (2000) 1(3), pp. 287-292.

8. Protein-over expression and crystallography Evdokimov, A.G., Anderson, D.E., Routzahn, K.M. & Waugh, D.S.

9. Overproduction, purification, crystallization and preliminary X-ray diffraction analysis of YopM, an essential virulence factor extruded by the plague bacterium Yersinia pestis. Acta Crystallography (2000) D56, 1676-1679.

10. Evdokimov, et al. Structure of the N-terminal domain of Yersinia pestis YopH at 2.0 A resolution. Acta Crystallographica D57, 793-799 (2001).

11. Lao, G. et al. Overexpression of Trehalose Synthase and Accumulation of Intracellular Trehalose in 293H and 293FTetR:Hyg Cells. Cryobiology 43(2):106-113 (2001).

12. High-throughput cloning and expression Albertha J. M. Walhout, Gary F. Temple, Michael A. Brasch, James L. Hartley, Monique A. Lorson, Sander Van Den Huevel, and Marc Vidal.

13. Gateway Recombinational Cloning: Application to the Cloning of Large Numbers of Open Reading Frames or ORFeomes. Methods in Enzymology, Vol. 328, 575-592.

14. Wiemann, S. et.al., Toward a Catalog of Human Genes and Proteins: Sequencing and Analysis of 500 Novel Complete Protein Coding Human cDNAs, Genome Research (March 2001) Vol. 11, Issue 3, pp.422-435

15. Reviewed in NATURE: Free Access to cDNA provides impetus to gene function work. 15 march 2001, p. 289. Generating directional cDNA libraries using recombination

16. Osamu Ohara and Gary F. Temple. Directional cDNA library construction assisted by the in vitro recombination reaction. Nucleic Acids Research 2001, Vol. 29, no. 4. RNA interference (RNAi)

17. Varsha Wesley, S. et al. Construct design for efficient, effective and highthroughput gene silencing in plants. The Plant Journal 27(6), 581-590 (2001). Generation of retroviral constructs

18. Loftus S K et al. Generation of RCAS vectors useful for functional genomic analyses. DNA Res 31;8(5):221 (2001).

19. James L. Hartley, Gary F. Temple and Michael A. Brasch. DNA Cloning Using In Vitro Site-Specific Recombination. Genome Research (2000) 10(11), pp. 1788-1795.

20. Reboul et al. Open-reading frame sequence tags (OSTs) support the existence of at least 17,300 genes in C. elegans. Nature Genetics 27(3):332-226 (2001).

21. Kneidinger, B. et al. Identification of two GDP-6-deoxy-D-lyxo-4-hexulose reductase synthesizing GDP-D-rhamnose in Aneurinibacillus thermoaerophilus L420-91T*. JBC 276(8) (2001).

The attP1 sequence (pDONR) is:
AATAATGATT TTATTTTGAC TGATAGTGAC CTGTTCGTTG CAACAAATTG ATGAGCAATGCTTTTTTAT AATGCCAACT TTGTACAAAA AAGC[TGAACG AGAAACGTAA AATGATATAA ATATCAATAT ATTAAATTAG ATTTTGCATA AAAAACAGACTA CATAATACTG TAAAACACAA CATATCCAGT CACTATGAAT CAACTACTTA GATGGTATTA GTGACCTGTA]

The region within brackets is where the site is "cut" and replaced by the attB1-fragment sequence to make an attL1 site. The sequence GTACAAA is the overlap sequence present in all att1 sites and is always "cut" right before the first G.

The overlap sequence in attP2 sites is CTTGTAC and cut before C. This is attP2:
ACAGGTCACT AATACCATCT AAGTAGTTGA TTCATAGTGA CTGGATATGT TGTGTTTTAC AGTATTATGT AGTCTGTTTT TTATGCAAAA TCTAATTTAA TATATTGATA TTTATATCAT TTTACGTTTC TCGTTCAGCT TTCTTGTACA AAGTTGGCAT TATAAGAAAG CATTGCTTAT AATTTGTTG CAACGAACAG GTCACTATCA GTCAAAATAA AATCATTATT

So, attL1 (Entry Clone) should be:
A ATAATGATTT TATTTTGACT GATAGTGACC TGTTCGTTGC AACAAATTGA TGAGCAATGC TTTTTTATAA TGCCAACT TT G TAC AAA AAA GC[A GGC T]NN NNN

attL2 (Entry Clone) should be:
NNN N[AC C]CA GCT TT CTTGTACA AAGTTGGCAT TATAAGAAAG CATTGCTTAT CAATTTGTTG CAACGAACAG GTCACTATCA GTCAAAATAA AATCATTATT

The sequence in brackets comes from attB, and N is your gene-specific sequence.

Note: When creating an Entry Clone through the BP reaction and a PCR product, the vector backbone is not the same as Gateway Entry vectors. The backbone in the case of PCR BP cloning is pDONR201.

There is no size restriction on the PCR fragments if they are cloned into a pDONR vector. The upper limit for efficient cloning into a TOPO adapted Gateway Entry vector is approximately 5 kb. A Gateway recombination reaction can occur between DNA fragments that are as large as 150 kb.

Destination vectors that contain N-terminal fusion partners will express proteins that contain amino acids contributed from the attB1 site, which is 25 bases long. This means that in addition to any tag (6x His and/or antibody epitope tag), the N-terminus of an expressed protein will contain an additional 9 amino acids from the attB1 sequence - the typical amino acid sequence is Thr-Ser-Leu-Tyr-Lys-Lys-Ala-Gly-nnn, where nnn will depend on the codon sequence of the insert.

Effects on protein function: A researcher (Simpson et al. EMBO Reports 11(31):287-292, 2000) demonstrated that GFP fusions (N- terminal and C-terminal) localized to the proper intracellular compartment. The expression constructs were generated using Gateway cloning, so the recombinant protein contained the attB1 or attB2 amino acid sequence. The localization function of the cloned recombinant proteins was preserved.

Effects on expression: We have seen no effect of the attB sites on expression levels in E. coli, insect and mammalian cells. The gus gene was cloned into bacterial expression vectors (for native and N-terminal fusion protein expression) using standard cloning techniques and expressed in bacteria. Gus was also cloned into Gateway Destination vectors (for native and N-terminal fusion expression) and expressed. When protein expression is compared, there was no difference in the amount of protein produced. This demonstrates that for this particular case, the attB sites do not interfere with transcription or translation.

Effects on solubility: A researcher at the NCI has shown that Maltose Binding Protein fusions constructed with Gateway Cloning were soluble. The fusion proteins expressed had the attB amino acid sequence between the Maltose Binding Protein and the cloned protein. It is possible that some proteins containing the attB sequence could remain insoluble when expressed in E.coli.

Effects on folding: Two Hybrids screens show the same interacters identified with and without the attB sequence. Presumably correct protein folding would be required for protein-protein interactions to take place. It is possible that some proteins containing the attB sequence may not fold correctly.

Since the attB sequences are on the 5' end of oligos, they will not anneal to the target template in the first round of PCR. Sometimes the PCR product is more specific with the attB primers, probably due to the longer annealing sequence (all of attB plus gene specific sequence) after the first round of amplification. Generally there is no need to change PCR reaction conditions when primers have the additional attB sequence

No, this is not really feasible due to the fact that the attL sequence is approximately 100 bp, which is too long for efficient oligo synthesis. Our own maximum sequence length for ordering custom primers is 100 nucleotides. In contrast, the attB sequences are only 25 bp long, which is a very reasonable length for adding onto the 5' end of gene-specific PCR primers.

Vector information can be found in the product manuals or directly on our web site by entering the catalog number of the product in the search box. The vector map, cloning site diagram, and sequence information will be linked to the product page.

The Gateway nomenclature is consistent with lambda nomenclature, but we use numbers to differentiate between modified versions of the att sites (attB1, attB2, attP1, attP2, and so on). We have introduced mutations in the att sites to provide specificity and directionality to the recombination reaction. For example, attB1 will only recombine with attP1 and not with attP2.

The first step is to create an Entry clone for your gene of interest. We have 3 options to do this: The first is by BP recombination reaction using the PCR Cloning System with Gateway Technology. This is recommended for cloning large (>5 kb) PCR products. We also have Gateway compatible TOPO Cloning vectors such as pCR8/GW/TOPO and pENTR/D-TOPO. The final option is to use restriction enzymes to clone into a pENTR Dual Selection vector.

The gene of interest must be flanked by the appropriate att sites, either attL (100 bp) in an Entry clone or attB (25 bp) in a PCR product. For Entry clones, everything between the attL sites will be shuttled into the Gateway destination vector containing attR sites, and a PCR product flanked by attB sites must be shuttled into an attP-containing donor vector such as pDONR221.

The location of translation initiation sites, stop codons, or fusion tags for expression must be considered in your initial cloning design. For example, if your destination vector contains an N-terminal tag but does not have a C-terminal tag, the vector should already contain the appropriate translation start site but the stop codon should be included in your insert.

Yes, increasing the incubation time from 1 hour to 4 hours will generally increase colony numbers 2-3 fold. An overnight incubation at room temperature will typically increase colony yield by 5-10 fold.

BP Clonase II and LR Clonase II can be freeze/thawed at least 10 times without significant loss of activity. However, you may still want to aliquot the enzymes to keep freeze/thaw variability to a minimum.

These enzymes are more stable than the original BP and LR Clonase and can be stored at -20 degrees C for 6 months.

Mini-prep (alkaline lysis) DNA preparations work well in Gateway cloning reactions. It is important that the procedure remove contaminating RNA for accurate quantification. Plasmid DNA purified with our S.N.A.P. nucleic acid purification kits, ChargeSwitch kits, or PureLink kits are recommended.

A simple way to express a protein with a leader sequence is to have the leader sequence encoded in the destination vector. The other option is to have the leader sequence subcloned into the entry vector using restriction enzymes, or incorporate the leader sequence into the forward PCR primer when cloning a PCR product into the entry vector. Please see Esposito et al. (2005), Prot. Exp. & Purif. 40, 424-428 for an example of how a partial leader sequence for secretion was incorporated into an entry vector.

This depends on whether you are expressing a fusion or a native protein in the Gateway destination vector. For an N-terminal fusion protein the ATG will be given by the destination vector and it will be upstream of the attB1 site. For a C-terminal fusion protein or a native protein, the ATG should be provided by your gene of interest, and it will be downstream of the attB1 site.

The Gateway attB sites are derived from the bacteriophage lambda site-specific recombination, but are modified to remove stop codons and reduce secondary structure. The core regions have also been modified for specificity (i.e., attB1 will recombine with attP1 but not with attP2).

Expression experiments have shown that the extra amino acids contributed by the attB site to a fusion protein will most likely have no effect on protein expression levels or stability. In addition, they do not appear to have any effect on two-hybrid interactions in yeast. However, as is true with the addition of any extra sequences that result from tags, the possible effects will be protein-dependent.

No, attB primers are highly specific under standard PCR conditions. We have amplified from RNA (RT-PCR), cDNA libraries, genomic DNA, and plasmid templates without any specificity problems.

The smallest size we have recombined is a 70 bp piece of DNA located between the att sites. Very small pieces are difficult to clone since they negatively influence the topology of the recombination reaction.

There is no theoretical size limitation. PCR products between 100 bp and 11 Kb have been readily cloned into a pDONR Gateway vector. Other DNA pieces as large as 150 kb with att sites will successfully recombine with a Gateway-compatible vector. Overnight incubation is recommended for large inserts.

Standard desalted purity is generally sufficient for creating attB primers. We examined HPLC-purified oligos for Gateway cloning (about 50 bp long) and found only about a 2-fold increase in colony number over standard desalted primers. If too few colonies are obtained, you may try to increase the amount of PCR product used and/or incubate the BP reaction overnight.

Gateway Cloning Technology is an easy-to-use system for cloning and subcloning DNA segments (e.g. genes of interest), facilitating gene functional analysis, protein expression, and the integration of technology platforms. One can also readily clone PCR products into so-called Gateway "Entry" vectors. To shuttle inserts from one vector to another, the Gateway Cloning Technology uses bacteriophage lambda-based site-specific recombination. There is no need to use restriction enzymes and ligase to subclone inserts.

One advantage of Gateway Cloning Technology is that genes present in a single Gateway Entry vector can be subcloned into multiple different Gateway Destination vectors. After this 1 hour in vitro subcloning reaction, a high percentage of the colonies obtained carry the desired expression clone. For more details, please see the product manual for cat# 12535029 or cat# 12535037.

Cosolvents may be used when there is a failure of amplification, either because the template contains stable hairpin-loops or the region of amplification is GC-rich. Keep in mind that all of these cosolvents have the effect of lowering enzyme activity, which will decrease amplification yield. For more information see P Landre et al (1995). The use of co-solvents to enhance amplification by the polymerase chain reaction. In: PCR Strategies, edited by MA Innis, DH Gelfand, JJ Sninsky. Academic Press, San Diego, CA, pp. 3-16.

Additionally, when amplifying very long PCR fragments (greater than 5 kb) the use of cosolvents is often recommended to help compensate for the increased melting temperature of these fragments.