missing translation for 'onlineSavingsMsg'
Learn More

Invitrogen™ pAd/CMV/V5-DEST™ Gateway™ Vector Kit

Catalog No. V49320
Encompass
Change view
Click to view available options
Quantity:
6 μg
1 product options available for selection
Product selection table with 1 available options. Use arrow keys to navigate and Enter or Space to select.
Catalog No. Quantity
V49320 6 μg
Use arrow keys to navigate between rows. Press Enter or Space to select a product option. 1 options available.
1 options
Catalog No. V49320 Supplier Invitrogen™ Supplier No. V49320

Includes

pAd-CMV/V5-DEST Vector 150ng/μL in TEBuffer, pH 8.0. 40μL; pAd/CMV/V5-GW/lacZ control plasmid 1μg/μL in TE Buffer, pH 8.0, 10μL.

For easy recombination-based cloning and adenoviral-based, transient expression of a target gene in dividing and nondividing mammalian cells

  • The vector allows generation of an adenovirus containing the target gene where constitutive, high-level expression is driven by the CMV promoter
  • High efficiency and rapid recombination cloning
  • Produces high titer adenoviral stocks
  • Efficient delivery of the gene to dividing and nondividing mammalian cells in vitro or in vivo
  • Produces replication-incompetent virus for enhanced biosafety of the system
  • Amenable for use in high-throughput applications
  • CMV promoter for high-level constitutive expression of gene of interest
  • Human Ad5 sequences (ΔE3) and Viral Inverted Terminal Repeats (ITRs) for packaging of the expression construct into virions
  • Herpes Simplex Virus thymidine kinase (TK) polyadenylation sequence for efficient transcription termination and polyadenylation of mRNA
  • V5 epitope for detection of recombinant protein
  • Ampicillin selection marker

Antibody and Cell Culture Production, Bioproduction, Cloning, Constitutive Expression, Gateway Cloning, Mammalian Expression, Protein Expression, Proteins, Expression, Isolation and Analysis, Viral Gene Delivery, Viral Vaccine Production

Specifications

Constitutive or Inducible System Constitutive
Delivery Type Adenoviral
Promoter CMV
Product Type Mammalian Expression Vector
Content And Storage • pAd-CMV⁄V5-DEST™ Vector 150 ng⁄μl in TEBuffer, pH 8.0. 40 μl (Store at -20°C)
• pAd⁄CMV⁄V5-GW⁄lacZ control plasmid 1 μg⁄μl in TE Buffer, pH 8.0. 10 μl (Store at -20°C)
Protein Tag V5 Epitope Tag
Cloning Method Gateway
Quantity 6 μg
Vector pDEST
Product Line Gateway, ViraPower
For Use With (Application) Viral Expression
Show More Show Less
Can I perform the single-step protocol for the BP/LR Clonase reaction using BP Clonase enzyme and LR Clonase enzyme instead of BP Clonase II enzyme and LR Clonase II enzyme?

In the single-step protocol for the BP/LR Clonase reaction, we would not recommend substituting the BP Clonase II/LR Clonase II enzymes with BP Clonase /LR Clonase enzymes as this would result in very low recombination efficiency.

Do you have a recommended single-step protocol for BP/LR recombination?

Yes, we have come up with a single-step protocol for BP/LR Clonase reaction (http://www.thermofisher.com/us/en/home/life-science/cloning/gateway-cloning.html#1), where DNA fragments can be cloned into Destination vectors in a single step reaction, allowing you to save time and money.

How can I move my gene of interest from a Gateway-adapted expression clone to a new Destination vector as I have lost the entry clone?

We would recommend performing a BP reaction with a Donor vector in order to obtain an entry clone. This entry clone can then be used in an LR reaction with the Destination vector to obtain the new expression clone.

Can I purchase the 5X LR Clonase buffer or 5X BP Clonase buffer separately?

We do not offer the 5X LR Clonase buffer and 5X BP Clonase buffer as standalone products. They are available as part of the enzyme kits.

Do you offer Gateway vectors for expression in plants?

We do not offer any Gateway vectors for expression in plants.

I am getting persistent toxicity effects when I transduce my target cells with my adenoviral stock. What is the issue?

Here are possible causes and solutions:

- Too much crude viral stock used:
-Reduce the amount of crude viral stock used for transduction or dilute the crude viral stock.
-Amplify the adenoviral stock.
-Concentrate the crude viral stock.

- Wild-type RCA (replication-competent adenovirus) contamination: Screen for RCA contamination. Plaque purify to isolate recombinant adenovirus or prepare a new adenoviral stock.

- Gene of interest is toxic to cells: Generation of constructs containing activated oncogenes or potentially harmful genes is not recommended.

I am getting very poor expression of my protein after adenoviral transduction. Can you offer some tips?

Here are possible causes and solutions:

- Poor transduction efficiency due to:
-Mammalian cells not healthy: Make sure that your cells are healthy before transduction.
-Non-dividing cell type used: Transduce your adenoviral construct into cells using a higher MOI.

- MOI too low: Transduce your adenoviral construct into cells using a higher MOI.

- Low viral titer: Amplify the adenoviral stock using the procedure on page 20 of the manual (http://tools.thermofisher.com/content/sfs/manuals/virapower_adenoviral_system_man.pdf).

- Adenoviral stock contaminated with RCA (replication-competent adenovirus):
-Screen for RCA contamination.
-Prepare a new adenoviral stock or plaque purify to isolate recombinant adenovirus.

- Cells harvested too soon after transduction: Do not harvest cells until at least 24 hours after transduction.

- Cells harvested too long after transduction: For actively dividing cells, assay for maximal levels of recombinant protein expression within 5 days of transduction.

- Gene of interest is toxic to cells: Generation of constructs containing activated oncogenes or potentially harmful genes is not recommended.

I obtained a good titer for my adenoviral stock but when I used it to transduce my specific cell line, I got no protein expression. Can you please help?

Here are possible causes and solutions:

- Viral stocks stored incorrectly: Aliquot and store stocks at –80 degrees C. Do not freeze/thaw more than 10 times.

- Gene of interest contains a PacI site: Perform mutagenesis to change or remove the PacI site.

I prepared my adenoviral stock but the titer was indeterminable even though the cells looked completely lysed. Did I do something wrong?

This could be due to insufficient dilution of the viral supernatant. We recommend titering the adenovirus stock using 10-fold serial dilutions ranging from 10e-4 to 10e-9.

I tried to titer my adenoviral stock and did not see any plaques. What could have happened?

Here are possible causes and solutions:

- Viral stocks stored incorrectly: Aliquot and store stocks at –80 degrees C. Do not freeze/thaw more than 10 times.

- Incorrect titering of cell line used: Use the 293A cell line or any cell line with the characteristics discussed on page 23 of the manual http://tools.thermofisher.com/content/sfs/manuals/virapower_adenoviral_system_man.pdf).

- Agarose overlay incorrectly prepared: Make sure that the agarose is not too hot before addition to the cells; hot agarose will kill the cells.
- Viral stock with very low titer or very high titer: Titer adenovirus using a wider range of 10-fold serial dilutions (e.g.,10e2 to 10e8).

I am using your ViraPower Adenoviral Expression System and am getting a low adenoviral titer. Can you offer some troubleshooting tips?

Here are possible causes and solutions:

- Low transfection efficiency due to:
-Shearing of adenoviral Destination vector DNA: Use care when handling the adenoviral Destination vector. Do not perform excessive manipulations (e.g.,vortexing or pipetting the solution vigorously) that may shear the DNA.
-Incomplete PacI digestion or digested DNA contaminated with phenol, ethanol, or salts: Repeat the Pac I digestion. Make sure purified DNA is not contaminated with phenol, ethanol, or salts.
-Unhealthy 293A cells; cells exhibit low viability: Use healthy 293A cells; do not overgrow cells.
-293A cells plated too sparsely on the day before transfection: Cells should be 90-95% confluent at the time of transfection.
-Plasmid DNA: transfection reagent ratio incorrect: Optimize such that plasmid DNA (in µg):Lipofectamine 2000 (in µL) ratio ranges from 1:2 to 1:3. If you are using another transfection reagent, optimize according to the manufacturer's recommendations.

- Viral supernatant too dilute: Concentrate virus using CsCl purification or any method of choice.

- Viral supernatant frozen and thawed multiple times: Do not freeze/thaw viral supernatant more than 10 times.

- Gene of interest is large: Viral titers generally decrease as the size of the insert increases; inserts larger than 6 kb (for pAd/CMV/V5-DEST) and 7.5 kb (for pAd/PL-DEST) are not recommended.

- Gene of interest is toxic to cells: Generation of constructs containing activated oncogenes or potentially harmful genes is not recommended.

I am using your ViraPower Adenoviral Expression System. I set up a negative control for the LR reaction where I did not add LR Clonase II but I got very high background after transformation. Can you explain why this could have happened?

Here are possible causes and solutions:

- LR reaction transformed into an E. coli strain containing the F' episome and the ccdA gene: Use an E. coli strain that does not contain the F' episome for transformation (e.g.,TOP10, DH5α-T1R).

- Deletions (full or partial) of the ccdB gene from adenoviral Destination vector:
- The adenoviral Destination vectors are provided in solution and are ready to use in an LR reaction. However, if you wish to propagate them, we recommend using One Shot ccdB Survival2 T1R Chemically Competent Cells (Cat. No. A10460).
- Select for transformants in media containing 50-100 µg/mL ampicillin and 15-30 µg/mL chloramphenicol, to maintain the integrity of the vector.
- Prepare plasmid DNA from one or more colonies and verify the integrity of the vector before use.

After the LR recombination of my entry clone with your adenoviral Destination vector, I obtained very few colonies even though my transformation control gave a lot of colonies. What could have happened?

Here are possible causes and solutions:

- Incorrect antibiotic used to select for transformants: Select for transformants on LB agar plates containing 100 µg/mL ampicillin.

- LR recombination reaction not treated with proteinase K: Treat reaction with proteinase K before transformation.

- Too much entry clone DNA used in the LR reaction: Use 50-150 ng of the entry clone in the LR reaction.

- Inappropriate ratio of entry clone:DEST vector used in the LR reaction: Aim for a 1:1 molar ratio of entry clone:DEST vector.

- LR recombination of >5 kb insert only incubated for 1 hr: For inserts larger than 5 kb, we recommend to incubate the LR reaction overnight. Note: This overnight incubation will also boost colony count for smaller inserts.

- Adenoviral Destination vector DNA was sheared: Use care when handling the adenoviral Destination vector. Do not perform excessive manipulations (e.g.,vortexing or pipetting the solution vigorously) that may shear the DNA.

- Didn't use the suggested amount of LR Clonase II enzyme mix or LR Clonase II enzyme mix was inactive:
-Make sure to store the LR Clonase II enzyme mix at –20 degrees C.
-Do not freeze/thaw the LR Clonase II enzyme mix more than 10 times.
-Use the recommended amount of LR Clonase II enzyme mix (see page 14 of the manual [http://tools.thermofisher.com/content/sfs/manuals/pad_dest_man.pdf]).
-Test another aliquot of the LR Clonase II enzyme mix.

- Not enough LR reaction transformed: Transform 2-3 µL of the LR reaction into the appropriate competent E. coli strain. Use E. coli cells with a transformation efficiency >1 x 10e8 cfu/µg.

- Not enough transformation mixture plated: Increase the amount of E. coli plated.

What are the safety features built into the ViraPower Adenoviral Expression System?

The ViraPower Adenoviral Expression System includes the following features designed to enhance its biosafety:

- The entire E1 gene is deleted in the adenoviral expression vectors (pAd/CMV/V5-DEST and pAd/PLDEST) and supplied in trans in the 293A producer cell line. Since expression of E1 (E1a and E1b) proteins is required for the expression of the other adenoviral viral genes (e.g., late genes), adenovirus produced using this system is replication-incompetent in any mammalian cells that do not express the E1a and E1b proteins.

- The E3 gene is completely dispensable for in vitro applications and hence is deleted as well from the adenoviral expression vector backbone.

- The adenovirus does not integrate into the host genome upon transduction. Because the virus is replication-incompetent, the presence of the viral genome is transient and will eventually be diluted out as cell division occurs.

Despite the presence of the above safety features, the adenovirus produced can still pose some biohazardous risk since it can transduce primary human cells. For this reason, we highly recommend that you treat adenoviral stocks generated using this system as Biosafety Level 2 (BL-2) organisms and strictly follow all published guidelines for BL-2. Furthermore, exercise extra caution when creating adenovirus carrying potential harmful or toxic genes (e.g., activated oncogenes) or when producing large-scale preparations of virus (see page 10 of the manual [http://tools.thermofisher.com/content/sfs/manuals/virapower_adenoviral_system_man.pdf]).

For more information about the BL-2 guidelines and adenovirus handling, refer to the document, “Biosafety in Microbiological and Biomedical Laboratories,” 4th Edition, published by the Centers for Disease Control (CDC) (www.cdc.gov/biosafety/publications/index.htm).

How crucial is the transfection efficiency when using the ViraPower Adenoviral Expression System? Will low transfection efficiencies still produce virus?

Getting a cell transfected and observing productive viral transduction are two different things. If only one or two cells in your lawn are producing virus, it will take quite a while for that to be visible to the naked eye (longer than most are willing to wait). Transfection efficiency is correlated with virus production because the more cells you get DNA into, the higher chance you have of seeing virus production within the first week or two. If your transfection efficiency is low, you will eventually see virus being produced, but you have to wait a long time to see it.

Is long-term expression of my recombinant protein possible using adenovirus?

The pAd/CMV/V5-DEST or pAd/PL-DEST adenoviral constructs do not integrate into the host genome. Once transduced into the mammalian cell of interest, your recombinant protein is expressed as long as the viral genome is present. For actively dividing cells, transgene expression decreases over time and can be down to background levels within 2 weeks after transduction. In non-dividing cells such as quiescent CD34+ cells or animal tissues (skeletal muscle, neurons, liver), transgene expression is more stable and can persist for as long as 6 months post-transduction.

In actively dividing cells (doubling time of every 24 hours), we have found that transgene expression is generally detectable within 24 hours of transduction, with maximal expression observed at 48-96 hours (2-4 days) post-transduction. Expression levels generally start to decline after 5 days post-transduction. In cell lines that exhibit longer doubling times or in non-dividing cell lines, high levels of transgene expression persist for a longer period of time.

How do I determine whether my specific cell type can be transduced using adenovirus?

Human adenovirus type 5 (Ad5) enters target cells via the coxsackie virus and adenovirus receptor (CAR), followed by an integrin-mediated internalization mechanism. CAR/integrin proteins are ubiquitously present on mammalian cells, thus affording adenovirus the ability to transduce a very broad range of cell types. If your specific cell type has very low expression of CAR, adenoviral transduction will be inefficient, in which case you may need to use a very high MOI (in the 100s) to get good expression.

What kind of transduction efficiency should I expect to achieve with your ViraPower Adenoviral Expression System?

The backbone for our ViraPower adenoviral expression vectors is human adenovirus type 5 (Ad5). Ad5 entry into cells is achieved by binding to the coxsackie virus and adenovirus receptor (CAR), followed by an integrin-mediated internalization mechanism. For target cells that have sufficient expression of the CAR receptor and are actively dividing, it should be possible to get adenovirus transduction efficiencies in the range of 80-90%, as long as an adequate MOI is used.

Note: There is variability in the transduction efficiencies of different cell types. Example: In HT1080 cells, which are readily transduced with adenovirus, transduction efficiencies are around 90% with an MOI of 1. In some cell types, you may need to use a 10-fold higher MOI to get the same transduction efficiency.

What kind of viral titers should I expect to achieve with adenovirus?

Crude adenovirus titers are generally 1 x 10e7 to 1 x 10e8 plaque forming unts (pfu)/mL. You can use this stock to infect a new batch of 293A cells to generate a higher-titer viral stock (i.e., amplify the virus). Amplification allows production of a viral stock with a titer ranging from 1 x 10e8 to 1 x 10e9 pfu/mL. Adenovirus can be concentrated to titers as high as 1 x 10e11 pfu/mL using a variety of methods (e.g., CsCl purification).

How do I concentrate my adenoviral stock?

Adenovirus can be concentrated to titers as high as 1 x 10e11 pfu/mL using a variety of methods (e.g., CsCl purification; please find a reference on page 25 of the manual [http://tools.thermofisher.com/content/sfs/manuals/virapower_adenoviral_system_man.pdf]).

How can I amplify my adenoviral stock?

Once you have created a crude viral stock, you can use this stock to infect a new batch of 293A cells to generate a higher-titer viral stock (i.e., amplify the virus). The titer of the initial viral stock obtained from transfecting 293A cells generally ranges from 1 x 10e7 to 1 x 10e8 plaque forming units (pfu)/mL. Amplification allows production of a viral stock with a titer ranging from 1 x 10e8 to 1 x 10e9 pfu/mL and is generally recommended. Please refer to page 19 in the manual (http://tools.thermofisher.com/content/sfs/manuals/virapower_adenoviral_system_man.pdf) for specific instructions for amplification.

Note: Other 293 cell lines or cell lines expressing the E1 proteins are suitable for amplification.

How should I store my adenoviral stocks?

We recommend aliquoting adenoviral stocks immediately after production into small working volumes, and storing at –80 degrees C for long-term storage. Since adenovirus is non-enveloped, viral stocks remain relatively stable and some freezing and thawing of the viral stocks is acceptable. We do not recommend freezing and thawing viral stocks more than 10 times, as loss of viral titer can occur. When stored properly, viral stocks of an appropriate titer should be suitable for use for up to one year. After long-term storage, we recommend re-titering your viral stocks before use.

At what point can I stop changing the medium on the plates producing adenovirus? It seems that I will be removing adenovirus when replacing the medium.

Most of the adenovirus is contained within the floating cells and is not released into the medium until those cells burst. We recommend changing the medium every 3 days or so until it is obvious that a lot of cells become big and rounded and are detaching from the plastic. Once a cell bursts, the free viruses rapidly infect the neighboring cells. If you're ever worried that you're losing infected cells (and therefore potential virus) in your medium changes, you can always save the medium with the floating cells, freeze/thaw it 3 times and then use a little (maybe 1/10th) and add it back to your culture with fresh media. Or, replace only half of the medium with fresh medium and do this more often than every three days.

Can I use any 293 cells for adenovirus production?

Any 293-derived cell line or other cell line that expresses the E1 proteins may be used to produce adenovirus. In 293A cells (recommended for adenovirus production), "A" stands for "adherent" because the 293A cells (which are just a single-cell clone of regular 293) tend to adhere and form nice flat monolayers in tissue culture dishes. This is why they work so well for plaque assays. Regular 293 cells will not form the same type of monolayers; they exhibit holes and gaps during growth.

Do you recommend a specific FBS for culturing 293A cells? Which plastic plates do you recommend?

We use mycoplasma-tested Gibco FBS (Cat. No. 16000-044) and use the following plasticware for 293A cells:

T175: Fisher Cat. No. 10-126-13; this is a Falcon flask with a 0.2 µm vented plug seal cap.

T75: Fisher Cat. No. 07-200-68; this is a Costar flask with a 0.2 µm vented seal cap.

100 mm plate: Fisher Cat. No. 08-772E; this is a Falcon tissue culture-treated polystyrene plate.

We get excellent adherence on these plates under routine cell culture/maintenance conditions (expect cell lysis in 293A cells when making adenovirus).

What is the packaging limit for the adenoviral system?

The size of the wild-type adenovirus type 5 genome is approximately 35.9 kb. Studies have demonstrated that recombinant adenovirus can efficiently package up to 108% of the wild-type virus size from E1- and E3-deleted vectors. Taking into account the size of the elements required for expression from each adenoviral destination vector, make sure that your DNA sequence or gene of interest does not exceed the size indicated for efficient packaging (see below for packaging limits for individual vectors):

pAd/CMV/V5-DEST: 6 kb
pAd/PL-DEST: 7.5 kb

Can I screen for expression of my protein during the first transfection (using just the adenoviral construct)?

You can transfect your adenoviral construct into your expression cell line (or the 293A cells) to see if the protein will be expressed without waiting the two weeks it takes to make virus. Transfection efficiency will be low due to the large size of the plasmid, so it may require adding more lipid-DNA complexes to the medium than indicated in the ViraPower Adenoviral Expression System manual. The adenoviral construct should not be digested with Pac I when doing this, as supercoiled plasmids transfect more efficiently. If checking expression in 293A cells, harvest 2-3 days post-transfection.

Why is it necessary to digest the adenoviral expression construct with Pac I, before transfection into 293A cells?

Before you can transfect your expression clone into 293A cells, you must expose the left and right viral inverted terminal repeats (ITRs) on the vector to allow proper viral replication and packaging. This also removes bacterial sequences (i.e., pUC origin and ampicillin resistance gene). Both pAd/CMV/V5-DEST and pAd/PL-DEST ;vectors contain Pac I restriction sites (see maps on pages 20 and 22 of the manual (http://tools.thermofisher.com/content/sfs/manuals/pad_dest_man.pdf), respectively, for the location of the Pac I sites).

Note: Make sure that your DNA sequence of interest does not contain any Pac I restriction sites. If you are unable to use the Pac I site, you can use the Swa I site.

I have generated my adenoviral expression clone. How should I purify the plasmid DNA?

Once you have generated your pAd/CMV/V5-DEST or pAd/PL-DEST expression clone, you may use any method of choice to prepare purified plasmid DNA. We recommend isolating plasmid DNA using the PureLink HiPure Plasmid Midiprep Kit (Cat. No. K210004) or CsCl gradient centrifugation.

Note: We recommend performing restriction analysis to verify the integrity of your expression construct after plasmid preparation.

How should I store my adenoviral expression vector?

We recommend storing adenoviral expression vectors at –20 degrees C. Due to their relatively large size, we do not recommend storing these vectors at –80 degrees C, as the vector solution will completely freeze and too many freeze thaws from –80 degrees C will affect the cloning efficiency.

Should I take any special precautions while handling the adenoviral destination vectors?

The pAd-DEST plasmids are large (>34 kb in size) and excessive manipulations can shear the DNA, resulting in reduced LR recombination efficiency. When working with pAd-DEST plasmids, do not vortex or pipet the solution vigorously. These vectors are supplied supercoiled, as lyophilization methods and room temperature storage may result in plasmid damage. Freeze thaws are acceptable as long as shearing is prevented.

Does your ViraPower adenoviral expression system use an adeno-associated virus?

No, our system uses human adenovirus type 5 (Ad5).

What is the backbone for your ViraPower adenoviral expression vectors?

The backbone for our ViraPoweradenoviral expression vectors is human adenovirus type 5 (Ad5).

I performed stable selection but my antibiotic-resistant clones do not express my gene of interest. What could have gone wrong?

Here are possible causes and solutions:

Detection method may not be appropriate or sensitive enough:
- We recommend optimizing the detection protocol or finding more sensitive methods. If the protein is being detected by Coomassie/silver staining, we recommend doing a western blot for increased sensitivity. The presence of endogenous proteins in the lysate may obscure the protein of interest in a Coomassie/silver stain. If available, we recommend using a positive control for the western blot.
- Insufficient number of clones screened: Screen at least 20 clones.
- Inappropriate antibiotic concentration used for stable selection: Make sure the antibiotic kill curve was performed correctly. Since the potency of a given antibiotic depends upon cell type, serum, medium, and culture technique, the dose must be determined each time a stable selection is performed. Even the stable cell lines we offer may be more or less sensitive to the dose we recommend if the medium or serum is significantly different.
- Expression of gene product (even low level) may not be compatible with growth of the cell line: Use an inducible expression system.
- Negative clones may result from preferential linearization at a vector site critical for expression of the gene of interest: Linearize the vector at a site that is not critical for expression, such as within the bacterial resistance marker.

I used a mammalian expression vector but do not get any expression of my protein. Can you help me troubleshoot?

Here are possible causes and solutions:

- Try the control expression that is included in the kit
Possible detection problem:

- Detection of expressed protein may not be possible in a transient transfection, since the transfection efficiency may be too low for detection by methods that assess the entire transfected population. We recommend optimizing the transfection efficiency, doing stable selection, or using methods that permit examination of individual cells. You can also increase the level of expression by changing the promoter or cell type.
- Expression within the cell may be too low for the chosen detection method. We recommend optimizing the detection protocol or finding more sensitive methods. If the protein is being detected by Coomassie/silver staining, we recommend doing a western blot for increased sensitivity. The presence of endogenous proteins in the lysate may obscure the protein of interest in a Coomassie/silver stain. If available, we recommend using a positive control for the western blot. Protein might be degraded or truncated: Check on a Northern. Possible time-course issue: Since the expression of a protein over time will depend upon the nature of the protein, we always recommend doing a time course for expression. A pilot time-course assay will help to determine the optimal window for expression. Possible cloning issues: Verify clones by restriction digestion and/or sequencing.

I am using a mammalian expression vector that has the neomycin resistance gene. Can I use neomycin for stable selection in mammalian cells?

No; neomycin is toxic to mammalian cells. We recommend using Geneticin (a.k.a. G418 Sulfate), as it is a less toxic and very effective alternative for selection in mammalian cells.

Is it okay if my construct has an ATG that is upstream of the ATG in my gene of interest? Will it interfere with translation of my gene?

Translation initiation will occur at the first ATG encountered by the ribosome, although in the absence of a Kozak sequence, initiation will be relatively weak. Any insert downstream would express a fusion protein if it is in frame with this initial ATG, but levels of expressed protein are predicted to be low if there is a non-Kozak consensus sequence. If the vector contains a non-Kozak consensus ATG, we recommend that you clone your gene upstream of that ATG and include a Kozak sequence for optimal expression.

Do you offer a GFP-expressing mammalian expression vector that I can use as a control to monitor my transfection and expression?

We offer pJTI R4 Exp CMV EmGFP pA Vector, Cat. No. A14146, which you can use to monitor your transfection and expression.

Which competent E. coli do you recommend using for propagation of my Gateway-adapted mammalian Destination vector?

We recommend using One Shot ccdB Survival 2 T1R Competent Cells, Cat. No. A10460. This strain is resistant to the toxic effects of the ccdB gene. Note: Do not use general E. coli cloning strains, including TOP10 or DH5alpha, for propagation and maintenance, as these strains are sensitive to ccdB effects.

I am working with a mouse cell line and would like to express my gene at high levels using one of your vectors with the CMV promoter. Do you foresee any problems with this approach?

The CMV promoter is known to be downregulated over time in mouse cell lines. Hence, we recommend using one of our non-CMV vectors, such as those with the EF1alpha or UbC promoter, for long-term expression in mouse cell lines.

Do I need to include a consensus Kozak sequence when I clone my gene of interest into one of your mammalian expression vectors?

The consensus Kozak sequence is A/G NNATGG, where the ATG indicates the initiation codon. Point mutations in the nucleotides surrounding the ATG have been shown to modulate translation efficiency. Although we make a general recommendation to include a Kozak consensus sequence, the necessity depends on the gene of interest and often, the ATG alone may be sufficient for efficient translation initiation. The best advice is to keep the native start site found in the cDNA unless one knows that it is not functionally ideal. If concerned about expression, it is advisable to test two constructs, one with the native start site and the other with a consensus Kozak. In general, all expression vectors that have an N-terminal fusion will already have an initiation site for translation.

Do I need to include a ribosomal binding site (RBS/Shine Dalgarno sequence) or Kozak sequence when I clone my gene of interest?

ATG is often sufficient for efficient translation initiation although it depends upon the gene of interest. The best advice is to keep the native start site found in the cDNA unless one knows that it is not functionally ideal. If concerned about expression, it is advisable to test two constructs, one with the native start site and the other with a Shine Dalgarno sequence/RBS or consensus Kozak sequence (ACCAUGG), as the case may be. In general, all expression vectors that have an N-terminal fusion will already have a RBS or initiation site for translation.

How large of a PCR product can I recombine with a pDONR vector via BP cloning? Does the same apply for TOPO-adapted Entry vectors?

There is no theoretical limit to insert size for a BP reaction with a pDONR vector. Maximum size tested in-house is 12 kb. TOPO vectors are more sensitive to insert size and 3-5 kb is the upper limit for decent cloning efficiency.

How should I clean up my attB-PCR product?

After generating your attB-PCR product, we recommend purifying it to remove PCR buffer, unincorporated dNTPs, attB primers, and any attB primer-dimers. Primers and primer-dimers can recombine efficiently with the Donor vector in the BP reaction and may increase background after transformation into E. coli, whereas leftover PCR buffer may inhibit the BP reaction. Standard PCR product purification protocols using phenol/chloroform extraction followed by ammonium acetate and ethanol or isopropanol precipitation are not recommended for purification of the attB-PCR product as these protocols generally have exclusion limits of less than 100 bp and do not efficiently remove large primer-dimer products. We recommend a PEG purification protocol (see page 17 of the Gateway Technology with Clonase II manual). If you use the above protocol and your attB-PCR product is still not suitably purified, you may further gel-purify the product. We recommend using the PureLink Quick Gel Extraction kit.

I'm trying to propagate my Gateway destination vector and am not seeing any colonies. What should I do?

Check the genotype of the cell strain you are using. Our Gateway destination vectors typically contain a ccdB cassette, which, if uninterrupted, will inhibit E. coli growth. Therefore, un-cloned vectors should be propagated in a ccdB survival cell strain, such as our ccdB Survival 2 T1R competent cells.

What is the difference between LR Clonase II and LR Clonase II Plus?

LR Clonase II Plus contains an optimized formulation of recombination enzymes for use in MultiSite Gateway LR reactions. LR Clonase and LR Clonase II enzyme mixes are not recommended for MultiSite Gateway LR recombination reactions, but LR Clonase II Plus is compatible with both multi-site and single-site LR recombination reactions.

What is the purpose of the Proteinase K step following a Gateway LR Recombination reaction, and is it critical to the results?

When the LR reaction is complete, the reaction is stopped with Proteinase K and transformed into E. coli resulting in an expression clone containing a gene of interest. A typical LR reaction followed by Proteinase K treatment yields about 35,000 to 150,000 colonies per 20ul reaction. Without the Proteinase K treatment, up to a 10 fold reduction in the number of colonies can be observed. Despite this reduction, there are often still enough colonies containing the gene of interest to proceed with your experiment, so the Proteinase K step can be left out after the LR reaction is complete if necessary.

Does the ViraPower Adenoviral Expression System use an adeno-associated virus?

No. The ViraPower system uses adenovirus type 5. Adenoviruses (Adenoviridae) and adeno-associated viruses (Parvoviridae) are completely different. Adeno-associated viruses are often associated with adenovirus infections, hence the name. Since they are thought to be virtually non-pathogenic, they are attractive vectors for gene therapy. The disadvantage is that they can package only about half the foreign DNA that adenoviruses can.

How does the adenoviral system work? How do I make an adenovirus expressing my gene of interest?

Clone your gene of interest into the pAd/CMV/V5-DEST (or pAd-PL-DEST if you want to use your own promoter). Prior to cloning, if desired, propagate this vector in One Shot ccdB Survival 2 T1R Competent Cells (Cat. No. A10460) as described below. After cloning your gene of interest, propagate in E. coli strain TOP10. pAd/CMV/V5-GW/lacZ is provided as a positive control vector for expression.

Digest recombinant plasmid with Pac I to expose the ITRs (inverted terminal repeats).

Transfect (we recommend Lipofectamine 2000 reagent) E1-containing cells (293A cells) with linear DNA (only 10% of transfected cells will make virus).

Infected cells will ball up, and release virus to surrounding cells, which in turn will be killed and ball up. Look for plaques in the monolayer created by areas cleared by detaching, balled up cells (it takes 8-10 days to see visible plaques from this initial transfection).

Collect a crude viral lysate.

Amplify the adenovirus by infecting 293A producer cells with the crude viral lysate. Harvest virus after 2-3 days when cells ball up. Determine the titer of the adenoviral stock by performing a plaque assay. The virus generated is adenovirus type 5 (subclass C).

Add the viral supernatant to your mammalian cell line of interest to transduce cells.

Assay for recombinant protein of interest.

Once you have your gene of interest in the adenoviral vector, you can simply re-amplify when you need more of the virus. You do not need to repeat cloning steps and transfections each time.

When cloning or propagating DNA with unstable inserts (such as lentiviral DNA containing direct repeats), we recommend using the following modifications to reduce the chance of recombination between direct repeats:
- Select and culture transformants at 25-30 degrees C.
- Do not use "rich" bacterial media as they tend to give rise to a greater number of unwanted recombinants.
-If your plasmid confers chloramphenicol resistance, select and culture transformants using LB medium containing 15-30 µg/mL chloramphenicol in addition to the antibiotic appropriate for selection of your plasmid.

How do I concentrate the lentiviral stock?

Ultracentrifugation is the most commonly used approach and is typically very successful (see Burns et al. (1993) Proc Natl Acad Sci USA 90:8033-8037; Reiser (2000) Gene Ther 7:910-913). Others have used PEG precipitation. Some purification methods are covered by patents issued to the University of California and Chiron.

Adenovirus is concentrated using CsCl density gradient centrifugation (there is a reference for this procedure in our adenovirus manual) or commercially available columns.

Will I get the same transduction efficiency with both lentivirus and adenovirus in the same cell line?

This depends entirely on the target cell. Adenovirus requires the coxsackie-adenovirus receptor (CAR) and an integrin for efficient transduction. Lentivirus (with VSV-G) binds to a lipid in the plasma membrane (present on all cell types). With two totally different mechanisms of entry into the cell, there will always be differences in transduction efficiencies. However, the efficiency of transduction for both viral systems is easily modulated by the multiplicity of infection (MOI) used.

Do you recommend a specific FBS for culture of the 293FT or 293A cells used in the ViraPower kits? What plastic plates do you recommend?

We use mycoplasma-tested Gibco FBS (Cat. No. 16000-044) without any modifications. We have observed that when 293FT cells are cultured in the presence of this FBS following the instructions in the manual, virus production is better than that obtained with many other serum sources.

We use the following plasticware for 293A and 293FT cells:

T175--Fisher Cat. No. 10-126-13; this is a Falcon flask with 0.2 µm vented plug seal cap.

T75--Fisher Cat. No. 07-200-68; this is a Costar flask with 0.2 µm vented seal cap.

100 mm plate--Fisher Cat. No. 08-772E; this is a Falcon tissue culture-treated polystyrene plate

We get excellent adherence on these plates under routine cell culture/maintenance conditions (expect cell lysis in 293A cells when making adenovirus).

How should I store lentivirus, adenovirus and viral vectors?

Viral vectors:
Store lentiviral and adenoviral expression vectors (plasmid DNA) at -20 degrees C. Due to their relatively large sizes, we do not recommend storing these vectors at -80 degrees C, as the vector solutions will completely freeze and too many freeze thaws from -80 degrees C will affect the cloning efficiency. At -20 degrees C, the vectors will be stable but will not freeze completely. Glycerol stocks of vectors transformed into bacteria should always be stored at -80 degrees C.

Virus:
Both adenovirus and lentivirus particles should be aliquoted immediately after production and stored at -80 degrees C.

Lentivirus is more sensitive to storage temperature and to freeze/thaw than adenovirus and should be handled with care. Adenovirus can typically be frozen/thawed up to 3 times without loss of titer, while lentivirus can lose up to 5% or more activity with each freeze/thaw. It is recommended to aliquot your virus into small working volumes immediately after production, freeze at -80 degrees C, and then thaw just one aliquot for titering. This way, every time you thaw a new aliquot it should be the same titer as your first tube.

Adenovirus particles can be kept overnight at 4 degrees C if necessary, but it is best to avoid this. Viruses will be most stable at -80 degrees C.

When stored properly, viral stocks should maintain consistent titer and be suitable for use for up to one year. After long-term storage, we recommend re-titering your viral stocks before use.

What are the safety issues associated with the use of your viral systems?

Both the lentiviral and adenoviral systems should be used following Biosafety Level 2 (BSL-2). We recommend strict adherence to all CDC guidelines for BSL-2 (as well as institutional guidelines). Thermo Fisher Scientific has also engineered specific safety features into the lentiviral system.

Consult the "Biosafety in Microbiological and Biomedical Laboratories" publication (www.cdc.gov, published by the CDC in the USA, describes BSL-2 handling) and the "Laboratory Biosafety Guidelines" publication (www.phac-aspc.gc.ca, published by the Centre for Emergency Preparedness and Response in Canada) for more information on safe handling of various organisms and the physical requirements for facilities that work with them.

How do I know whether to choose lentivirus or adenovirus for viral expression?

If you're interested in stable integration and selection, choose the lentiviral system. We offer both a Directional TOPO (D-TOPO) and Gateway version of the kit to provide flexibility in the cloning of the gene of interest.

If you're looking for transient gene expression, choose the adenoviral system. We offer the Gateway cloning method for this product. It should be noted, however, that gene expression from both systems is typically detected within 24-48 hours of transduction, so both systems can be used for experiments of a transient nature. The main difference is that lentivirus integrates into the host genome and adenovirus does not. Higher viral titers are achieved with the adenovirus.

What are the packaging limits for lentivirus and adenovirus? Can a 9 kb fragment be packaged into either?

No, neither lentivirus nor adenovirus can take an insert as large as 9 Kb. Lentiviral packaging limits are around 6 kb and adenoviral packaging limits are around 7-7.5 kb. Above that, no virus is made.

For lentivirus, titers will generally decrease as the size of the insert increases. We have effectively packaged inserts of 5.2 kb with good titer (approx. 0.5 x 10^5 cfu/mL). The size of the wild-type HIV-1 genome is approximately 10 kb. Since the size of the elements required for expression from pLenti vectors add up to approximately 4-4.4 kb, the size of your gene of interest should theoretically not exceed 5.6-6 kb for efficient packaging (see below for packaging limits for individual vectors).
pLenti4/V5-DEST vector: 6 kb
pLenti6/V5-DEST vector: 6 kb
pLenti6/V5/D-TOPO vector: 6 kb
pLenti6/UbC/V5-DEST vector: 5.6 kb

For adenovirus, the maximum packagable size is approximately 7-7.5 Kb (see below for packaging limits for individual vectors).
pAd/CMV/V5-DEST vector: 6 kb
pAd/PL-DEST vector: 7.5 kb

Can I go directly from a pENTR/D-TOPO reaction into an LR Clonase Reaction without first purifying the DNA?

In most cases, there will not be enough pENTR vector DNA present to go directly from TOPO cloning into an LR reaction. You need between 100-300 ng of pENTR vector for an efficient LR reaction, and miniprep of a colony from the TOPO transformation is necessary to obtain that much DNA. However, if you want to try it, here are some recommendations for attempting to go straight into LR reactions from the TOPO reaction using pENTR/D, or SD TOPO, or pCR8/GW/TOPO vectors:

1. Heat inactivate the topoisomerase after the TOPO cloning reaction by incubating the reaction at 85 degrees C for 15 minutes.
2. Use the entire reaction (6 µL) in the LR clonase reaction. No purification steps are necessary.
3. Divide the completed LR reaction into 4 tubes and carry out transformations with each tube. You cannot transform entire 20 µL reaction in one transformation, and we have not tried ethanol precipitation and then a single transformation.

When attempting this protocol, we observed very low efficiencies (~10 colonies/plate). So just be aware that while technically possible, going directly into an LR reaction from a TOPO reaction is very inefficient and will result in a very low colony number, if any at all.

Can N-terminal or C-terminal tags be attached to a Gateway Entry clone?

To have an N-terminal tag, the gene of interest must be in the correct reading frame when using non-TOPO adapted Gateway entry vectors. All TOPO adapted Gateway Entry vectors will automatically put the insert into the correct reading frame, and to add the N-terminal tag you simply recombine with a destination vector that has N-terminal tag.

To attach a C-terminal tag to your gene of interest, the insert must lack its stop codon, and be in the correct reading frame for compatibility with our C-terminal tagged destination vectors. Again, TOPO adapted Gateway Entry vectors will automatically put the insert into the correct reading frame. If you do not want the C-terminal tag to be expressed, simply include a stop codon at the end of the insert that is in frame with the initial ATG.

Generally, you need to choose a destination vector before you design and clone your insert into the Entry vector. This will determine whether you need to include an initiating ATG or stop codon with your insert.

Can you tell me the difference between a Shine-Dalgarno sequence and a Kozak sequence?

Prokaryotic mRNAs contain a Shine-Dalgarno sequence, also known as a ribosome binding site (RBS), which is composed of the polypurine sequence AGGAGG located just 5’ of the AUG initiation codon. This sequence allows the message to bind efficiently to the ribosome due to its complementarity with the 3’-end of the 16S rRNA. Similarly, eukaryotic (and specifically mammalian) mRNA also contains sequence information important for efficient translation. However, this sequence, termed a Kozak sequence, is not a true ribosome binding site, but rather a translation initiation enhancer. The Kozak consensus sequence is ACCAUGG, where AUG is the initiation codon. A purine (A/G) in position -3 has a dominant effect; with a pyrimidine (C/T) in position -3, translation becomes more sensitive to changes in positions -1, -2, and +4. Expression levels can be reduced up to 95% when the -3 position is changed from a purine to pyrimidine. The +4 position has less influence on expression levels where approximately 50% reduction is seen. See the following references:

- Kozak, M. (1986) Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell 44, 283-292.
- Kozak, M. (1987) At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells. J. Mol. Biol. 196, 947-950.
- Kozak, M. (1987) An analysis of 5´-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res. 15, 8125-8148.
- Kozak, M. (1989) The scanning model for translation: An update. J. Cell Biol. 108, 229-241.
- Kozak, M. (1990) Evaluation of the fidelity of initiation of translation in reticulocyte lysates from commercial sources. Nucleic Acids Res. 18, 2828.

Note: The optimal Kozak sequence for Drosophila differs slightly, and yeast do not follow this rule at all. See the following references:

- Romanos, M.A., Scorer, C.A., Clare, J.J. (1992) Foreign gene expression in yeast: a review. Yeast 8, 423-488.
- Cavaneer, D.R. (1987) Comparison of the consensus sequence flanking translational start sites in Drosophila and vertebrates. Nucleic Acids Res. 15, 1353-1361.

Can an attB-PCR product be cloned directly into an expression (Gateway Destination) vector?

No, not directly. The attB-PCR product must first be cloned, via a BP Clonase reaction, into a pDONR vector which creates an "Entry Clone" with attL sites. This clone can then be recombined, via an LR Clonase reaction, with a Destination vector containing attR sites. However, It is possible to perform both of these reactions in one step using the "One-Tube Protocol" described in the manual entitled "Gateway Technology with Clonase II".

Can Gateway technology be used to express two proteins from the same vector?

Yes, this can be done using the Multisite Gateway Technology. MultiSite Gateway Pro Technology enables you to efficiently and conveniently assemble multiple DNA fragments - including genes of interest, promoters, and IRES sequences - in the desired order and orientation into a Gateway Expression vector. Using specifically designed att sites for recombinational cloning, you can clone two, three, or four DNA fragments into any Gateway Destination vector containing attR1 and attR2 sites. The resulting expression clone is ready for downstream expression and analysis applications.

What is the efficiency of recombination in the Gateway system?

For the BP reaction, approximately 5-10% of the starting material is converted into product. For the LR reaction, approximately 30% of the starting material is converted into product.

Are there common restriction sites that can be used to excise a gene out of a Gateway plasmid?

The core region of the att sites contains the recognition sequence for the restriction enzyme BsrGI. Provided there are no BsrGI sites in the insert, this enzyme can be used to excise the full gene from most Gateway plasmids. The BsrGI recognition site is 5'-TGTACA and is found in both att sites flanking the insertion site.

If a different restriction site is desired, the appropriate sequence should be incorporated into your insert by PCR.

Do I have to synthesize new attB primers (29 base attB primer + my specific sequence primer) each time I want to make an attB PCR product, or do you have truncated attB primers that work together with adapter attB primers to get a complete attB sequence?

We do have an alternative method called the "attB Adapter PCR" Protocol in which you make your gene specific primer with only 12 additional attB bases and use attB universal adapter primers. This protocol allows for shorter primers to amplify attB-PCR products by utilizing four primers instead of the usual two in a PCR reaction. You can find the sequence of these primers in the protocol on page 45 of the "Gateway Technology with Clonase II" manual.

There is a protocol in which all 4 primers mentioned above are in a single PCR reaction. You can find this protocol at in the following article: Quest vol. 1, Issue 2, 2004. https://www.thermofisher.com/us/en/home/references/newsletters-and-journals/quest-archive.reg.in.html. The best ratio of the first gene-specific and the second attB primers was 1:10.

Do you have recommended sequencing primers for pDONR201?

We do not offer pre-made primers, but we can recommend the following sequences that can be ordered as custom primers for sequencing of pDONR201:
Forward primer, proximal to attL1: 5'- TCGCGTTAACGCTAGCATGGATCTC
Reverse primer, proximal to attL2: 5'-GTAACATCAGAGATTTTGAGACAC

Can you please list some references for Gateway Cloning Technology?

1. Yeast two-hybrid protein-protein interaction studies Walhout AJ, Sordella R, Lu X, Hartley JL, Temple GF, Brasch MA, Thierry-Mieg N, Vidal M.

2. Protein Interaction Mapping in C. elegans Using Proteins Involved in Vulval Development. Science Jan 7th 2000; 287(5450), 116-122 Davy, A. et al.

3. A protein-protein interaction map of the Caenorhabditis elegans 26S proteosome. EMBO Reports (2001) 2 (9), p. 821-828. Walhout, A.J.M. and Vidal, M. (2001).

4. High-throughput Yeast Two-Hybrid Assays for Large-Scale Protein Interaction mapping. Methods: A Companion to Methods in Enzymology 24(3), pp.297-306

5. Large Scale Analysis of Protein Complexes Gavin, AC et al. Functional Organization of the Yeast Proteome by Systematic Analysis of Protein Complexes. Nature Jan 10th 2002, 415, p. 141-147.

6. Systematic subcellular localisation of proteins Simpson, J.C., Wellenreuther, R., Poustka, A., Pepperkok, R. and Wiemann, S.

7. Systematic subcellular localization of novel proteins identified by large-scale cDNA sequencing. EMBO Reports (2000) 1(3), pp. 287-292.

8. Protein-over expression and crystallography Evdokimov, A.G., Anderson, D.E., Routzahn, K.M. & Waugh, D.S.

9. Overproduction, purification, crystallization and preliminary X-ray diffraction analysis of YopM, an essential virulence factor extruded by the plague bacterium Yersinia pestis. Acta Crystallography (2000) D56, 1676-1679.

10. Evdokimov, et al. Structure of the N-terminal domain of Yersinia pestis YopH at 2.0 A resolution. Acta Crystallographica D57, 793-799 (2001).

11. Lao, G. et al. Overexpression of Trehalose Synthase and Accumulation of Intracellular Trehalose in 293H and 293FTetR:Hyg Cells. Cryobiology 43(2):106-113 (2001).

12. High-throughput cloning and expression Albertha J. M. Walhout, Gary F. Temple, Michael A. Brasch, James L. Hartley, Monique A. Lorson, Sander Van Den Huevel, and Marc Vidal.

13. Gateway Recombinational Cloning: Application to the Cloning of Large Numbers of Open Reading Frames or ORFeomes. Methods in Enzymology, Vol. 328, 575-592.

14. Wiemann, S. et.al., Toward a Catalog of Human Genes and Proteins: Sequencing and Analysis of 500 Novel Complete Protein Coding Human cDNAs, Genome Research (March 2001) Vol. 11, Issue 3, pp.422-435

15. Reviewed in NATURE: Free Access to cDNA provides impetus to gene function work. 15 march 2001, p. 289. Generating directional cDNA libraries using recombination

16. Osamu Ohara and Gary F. Temple. Directional cDNA library construction assisted by the in vitro recombination reaction. Nucleic Acids Research 2001, Vol. 29, no. 4. RNA interference (RNAi)

17. Varsha Wesley, S. et al. Construct design for efficient, effective and highthroughput gene silencing in plants. The Plant Journal 27(6), 581-590 (2001). Generation of retroviral constructs

18. Loftus S K et al. Generation of RCAS vectors useful for functional genomic analyses. DNA Res 31;8(5):221 (2001).

19. James L. Hartley, Gary F. Temple and Michael A. Brasch. DNA Cloning Using In Vitro Site-Specific Recombination. Genome Research (2000) 10(11), pp. 1788-1795.

20. Reboul et al. Open-reading frame sequence tags (OSTs) support the existence of at least 17,300 genes in C. elegans. Nature Genetics 27(3):332-226 (2001).

21. Kneidinger, B. et al. Identification of two GDP-6-deoxy-D-lyxo-4-hexulose reductase synthesizing GDP-D-rhamnose in Aneurinibacillus thermoaerophilus L420-91T*. JBC 276(8) (2001).

What do attL1 and attL2 sites look like after recombination between attB and attP sites?

The attP1 sequence (pDONR) is:
AATAATGATT TTATTTTGAC TGATAGTGAC CTGTTCGTTG CAACAAATTG ATGAGCAATGCTTTTTTAT AATGCCAACT TTGTACAAAA AAGC[TGAACG AGAAACGTAA AATGATATAA ATATCAATAT ATTAAATTAG ATTTTGCATA AAAAACAGACTA CATAATACTG TAAAACACAA CATATCCAGT CACTATGAAT CAACTACTTA GATGGTATTA GTGACCTGTA]

The region within brackets is where the site is "cut" and replaced by the attB1-fragment sequence to make an attL1 site. The sequence GTACAAA is the overlap sequence present in all att1 sites and is always "cut" right before the first G.

The overlap sequence in attP2 sites is CTTGTAC and cut before C. This is attP2:
ACAGGTCACT AATACCATCT AAGTAGTTGA TTCATAGTGA CTGGATATGT TGTGTTTTAC AGTATTATGT AGTCTGTTTT TTATGCAAAA TCTAATTTAA TATATTGATA TTTATATCAT TTTACGTTTC TCGTTCAGCT TTCTTGTACA AAGTTGGCAT TATAAGAAAG CATTGCTTAT AATTTGTTG CAACGAACAG GTCACTATCA GTCAAAATAA AATCATTATT

So, attL1 (Entry Clone) should be:
A ATAATGATTT TATTTTGACT GATAGTGACC TGTTCGTTGC AACAAATTGA TGAGCAATGC TTTTTTATAA TGCCAACT TT G TAC AAA AAA GC[A GGC T]NN NNN

attL2 (Entry Clone) should be:
NNN N[AC C]CA GCT TT CTTGTACA AAGTTGGCAT TATAAGAAAG CATTGCTTAT CAATTTGTTG CAACGAACAG GTCACTATCA GTCAAAATAA AATCATTATT

The sequence in brackets comes from attB, and N is your gene-specific sequence.

Note: When creating an Entry Clone through the BP reaction and a PCR product, the vector backbone is not the same as Gateway Entry vectors. The backbone in the case of PCR BP cloning is pDONR201.

How large can PCR fragments be and still be cloned into a Gateway Entry vector?

There is no size restriction on the PCR fragments if they are cloned into a pDONR vector. The upper limit for efficient cloning into a TOPO adapted Gateway Entry vector is approximately 5 kb. A Gateway recombination reaction can occur between DNA fragments that are as large as 150 kb.

What is the influence of the attB sequence on protein function, solubility, folding, and expression?

Destination vectors that contain N-terminal fusion partners will express proteins that contain amino acids contributed from the attB1 site, which is 25 bases long. This means that in addition to any tag (6x His and/or antibody epitope tag), the N-terminus of an expressed protein will contain an additional 9 amino acids from the attB1 sequence - the typical amino acid sequence is Thr-Ser-Leu-Tyr-Lys-Lys-Ala-Gly-nnn, where nnn will depend on the codon sequence of the insert.

Effects on protein function: A researcher (Simpson et al. EMBO Reports 11(31):287-292, 2000) demonstrated that GFP fusions (N- terminal and C-terminal) localized to the proper intracellular compartment. The expression constructs were generated using Gateway cloning, so the recombinant protein contained the attB1 or attB2 amino acid sequence. The localization function of the cloned recombinant proteins was preserved.

Effects on expression: We have seen no effect of the attB sites on expression levels in E. coli, insect and mammalian cells. The gus gene was cloned into bacterial expression vectors (for native and N-terminal fusion protein expression) using standard cloning techniques and expressed in bacteria. Gus was also cloned into Gateway Destination vectors (for native and N-terminal fusion expression) and expressed. When protein expression is compared, there was no difference in the amount of protein produced. This demonstrates that for this particular case, the attB sites do not interfere with transcription or translation.

Effects on solubility: A researcher at the NCI has shown that Maltose Binding Protein fusions constructed with Gateway Cloning were soluble. The fusion proteins expressed had the attB amino acid sequence between the Maltose Binding Protein and the cloned protein. It is possible that some proteins containing the attB sequence could remain insoluble when expressed in E.coli.

Effects on folding: Two Hybrids screens show the same interacters identified with and without the attB sequence. Presumably correct protein folding would be required for protein-protein interactions to take place. It is possible that some proteins containing the attB sequence may not fold correctly.

Must PCR conditions be changed once the original PCR primers have attB sequence added to them?

Since the attB sequences are on the 5' end of oligos, they will not anneal to the target template in the first round of PCR. Sometimes the PCR product is more specific with the attB primers, probably due to the longer annealing sequence (all of attB plus gene specific sequence) after the first round of amplification. Generally there is no need to change PCR reaction conditions when primers have the additional attB sequence

Can PCR primers be tailed directly with attL sites for direct recombination into the destination vector?

No, this is not really feasible due to the fact that the attL sequence is approximately 100 bp, which is too long for efficient oligo synthesis. Our own maximum sequence length for ordering custom primers is 100 nucleotides. In contrast, the attB sequences are only 25 bp long, which is a very reasonable length for adding onto the 5' end of gene-specific PCR primers.

Where can I get Gateway vector sequences and maps?

Vector information can be found in the product manuals or directly on our web site by entering the catalog number of the product in the search box. The vector map, cloning site diagram, and sequence information will be linked to the product page.

From where does Gateway get its lambda nomenclature, and is it consistent with textbook nomenclature for lambda recombination?

The Gateway nomenclature is consistent with lambda nomenclature, but we use numbers to differentiate between modified versions of the att sites (attB1, attB2, attP1, attP2, and so on). We have introduced mutations in the att sites to provide specificity and directionality to the recombination reaction. For example, attB1 will only recombine with attP1 and not with attP2.

What is the first step in an experiment with the Gateway system?

The first step is to create an Entry clone for your gene of interest. We have 3 options to do this: The first is by BP recombination reaction using the PCR Cloning System with Gateway Technology. This is recommended for cloning large (>5 kb) PCR products. We also have Gateway compatible TOPO Cloning vectors such as pCR8/GW/TOPO and pENTR/D-TOPO. The final option is to use restriction enzymes to clone into a pENTR Dual Selection vector.

What are the prerequisites for Gateway cloning and expression?

The gene of interest must be flanked by the appropriate att sites, either attL (100 bp) in an Entry clone or attB (25 bp) in a PCR product. For Entry clones, everything between the attL sites will be shuttled into the Gateway destination vector containing attR sites, and a PCR product flanked by attB sites must be shuttled into an attP-containing donor vector such as pDONR221.

The location of translation initiation sites, stop codons, or fusion tags for expression must be considered in your initial cloning design. For example, if your destination vector contains an N-terminal tag but does not have a C-terminal tag, the vector should already contain the appropriate translation start site but the stop codon should be included in your insert.

Will increasing the Gateway cloning reaction time improve recombination efficiency?

Yes, increasing the incubation time from 1 hour to 4 hours will generally increase colony numbers 2-3 fold. An overnight incubation at room temperature will typically increase colony yield by 5-10 fold.

How many times can I thaw BP Clonase II and LR Clonase II?

BP Clonase II and LR Clonase II can be freeze/thawed at least 10 times without significant loss of activity. However, you may still want to aliquot the enzymes to keep freeze/thaw variability to a minimum.

These enzymes are more stable than the original BP and LR Clonase and can be stored at -20 degrees C for 6 months.

How clean must my DNA be to use in a Gateway cloning reaction?

Mini-prep (alkaline lysis) DNA preparations work well in Gateway cloning reactions. It is important that the procedure remove contaminating RNA for accurate quantification. Plasmid DNA purified with our S.N.A.P. nucleic acid purification kits, ChargeSwitch kits, or PureLink kits are recommended.

How would you incorporate a leader sequence for secretion into an entry vector?

A simple way to express a protein with a leader sequence is to have the leader sequence encoded in the destination vector. The other option is to have the leader sequence subcloned into the entry vector using restriction enzymes, or incorporate the leader sequence into the forward PCR primer when cloning a PCR product into the entry vector. Please see Esposito et al. (2005), Prot. Exp. & Purif. 40, 424-428 for an example of how a partial leader sequence for secretion was incorporated into an entry vector.

Where is the ATG relative to the 5' attB site in a Gateway expression clone?

This depends on whether you are expressing a fusion or a native protein in the Gateway destination vector. For an N-terminal fusion protein the ATG will be given by the destination vector and it will be upstream of the attB1 site. For a C-terminal fusion protein or a native protein, the ATG should be provided by your gene of interest, and it will be downstream of the attB1 site.

Are the Gateway attB1 and attB2 sites the same as the attB site used for recombination into E. coli by bacteriophage lambda?

The Gateway attB sites are derived from the bacteriophage lambda site-specific recombination, but are modified to remove stop codons and reduce secondary structure. The core regions have also been modified for specificity (i.e., attB1 will recombine with attP1 but not with attP2).

Will Gateway att sites affect the expression of my protein?

Expression experiments have shown that the extra amino acids contributed by the attB site to a fusion protein will most likely have no effect on protein expression levels or stability. In addition, they do not appear to have any effect on two-hybrid interactions in yeast. However, as is true with the addition of any extra sequences that result from tags, the possible effects will be protein-dependent.

Can the attB primers anneal in a non-specific manner?

No, attB primers are highly specific under standard PCR conditions. We have amplified from RNA (RT-PCR), cDNA libraries, genomic DNA, and plasmid templates without any specificity problems.

What is the smallest fragment that can be used in a Gateway reaction?

The smallest size we have recombined is a 70 bp piece of DNA located between the att sites. Very small pieces are difficult to clone since they negatively influence the topology of the recombination reaction.

Are there any limitations on the insert length in Gateway cloning?

There is no theoretical size limitation. PCR products between 100 bp and 11 Kb have been readily cloned into a pDONR Gateway vector. Other DNA pieces as large as 150 kb with att sites will successfully recombine with a Gateway-compatible vector. Overnight incubation is recommended for large inserts.

What primer purity should be used for adding attB sites to my PCR product?

Standard desalted purity is generally sufficient for creating attB primers. We examined HPLC-purified oligos for Gateway cloning (about 50 bp long) and found only about a 2-fold increase in colony number over standard desalted primers. If too few colonies are obtained, you may try to increase the amount of PCR product used and/or incubate the BP reaction overnight.

I sequenced one of your vectors after PCR amplification and observed a difference from what is provided online (or in the manual). Should I be concerned?

Our vectors have not been completely sequenced. Your sequence data may differ when compared to what is provided. Known mutations that do not affect the function of the vector are annotated in public databases.

Are your vectors routinely sequenced?

No, our vectors are not routinely sequenced. Quality control and release criteria utilize other methods.

How was the reference sequence for your vectors created?

Sequences provided for our vectors have been compiled from information in sequence databases, published sequences, and other sources.

What is the consensus Kozak sequence and what is the function of the Kozak sequence?

Eukaryotic (and specifically mammalian) mRNA contains sequence information that is important for efficient translation. However, this sequence, termed a Kozak sequence, is not a true ribosome binding site, but rather a translation initiation enhancer. The Kozak consensus sequence is ACCAUGG, where AUG is the initiation codon. A purine (A/G) in position -3 has a dominant effect; with a pyrimidine (C/T) in position -3, translation becomes more sensitive to changes in positions -1, -2, and +4. Expression levels can be reduced up to 95% when the -3 position is changed from a purine to pyrimidine. The +4 position has less influence on expression levels where approximately 50% reduction is seen. See the following references:

Kozak, M. (1986) Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell 44, 283-292.
Kozak, M. (1987) At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells. J. Mol. Biol. 196, 947-950.
Kozak, M. (1987) An analysis of 5´-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res. 15, 8125-8148.
Kozak, M. (1989) The scanning model for translation: An update. J. Cell Biol. 108, 229-241.
Kozak, M. (1990) Evaluation of the fidelity of initiation of translation in reticulocyte lysates from commercial sources. Nucleic Acids Res. 18, 2828.

Note: The optimal Kozak sequence for Drosophila differs slightly, and yeast do not follow this rule at all. See the following references:

Romanos, M.A., Scorer, C.A., Clare, J.J. (1992) Foreign gene expression in yeast: a review. Yeast 8, 423-488.
Cavaneer, D.R. (1987) Comparison of the consensus sequence flanking translational start sites in Drosophila and vertebrates. Nucleic Acids Res. 15, 1353-1361.


For Research Use Only. Not for use in diagnostic procedures.