missing translation for 'onlineSavingsMsg'
Learn More

Invitrogen™ T7 Promoter Primer

Catalog No. n56002
Encompass
Change view
Click to view available options
Quantity:
2 μg
1 product options available for selection
Product selection table with 1 available options. Use arrow keys to navigate and Enter or Space to select.
Catalog No. Quantity
N56002 2 μg
Use arrow keys to navigate between rows. Press Enter or Space to select a product option. 1 options available.
1 options
Catalog No. N56002 Supplier Invitrogen™ Supplier No. N56002
Only null left

Thermo Fisher Scientific offers primers for PCR amplification that complement many of the vectors currently available.

Thermo Fisher Scientific offers primers for PCR amplification that complement many of the vectors currently available. The T7 Promoter Primer is recognized by T7 RNA polymerase and is commonly used to regulate gene expression of recombinant proteins. Subsequent recombinant proteins may be used for further downstream research applications.

T7 Promoter Primer features include:
• Desalted and purified by gel filtration
• Assayed for function by PCR amplification
• Provided in 2 μg quantity

Applications
• Sanger sequencing
• PCR amplification

T7 Primer Sequence: 5´- TAATACGACTCACTATAGGG- 3´

Order Info

Shipping Conditions: Room Temperature

Specifications

Promoter T7
Product Type Primer
Content And Storage • T7 Promoter Primer (2 μg)

Store in Freezer at –20°C.
Guaranteed stable for 6 months when properly stored.
Primer Length 20-mer
Primer Sequence 5 ́d[TAATACGACTCACTATAGGG]3 ́
Purification Method Gel-purified
Shipping Condition Room Temperature
Primer T7
Quantity 2 μg
For Use With (Application) PCR Amplification
Form Lyophilized
Show More Show Less

For Research Use Only. Not for use in diagnostic procedures.