missing translation for 'onlineSavingsMsg'
Learn More
Please login to your online account to display your discounted pricing

Invitrogen™ T7 Promoter Primer DFS Item

Primers for PCR amplification that complement many vectors

Manufacturer:  Invitrogen™ LSN56002

Catalog No. N56002



Description

Description

  • Desalted and purified by gel filtration
  • Assayed for function by PCR amplification
  • Provided in 2μg quantity
  • T7: 5'- TAATACGACTCACTATAGGG- 3'

Sanger Sequencing, Sanger Sequencing Technology & Accessories, Sequencing

Order Info

Shipping Conditions: Room Temperature

Specifications

Specifications

327 picomole
Lyophilized
20 -mer
Gel-Purified
Primer are supplied lyophilized in 10 mM Tris-HCl, pH 7.5, 1 mM EDTA. Store at -20°C. Guaranteed stable for 6 months when properly stored.
2 µg
5´d[TAATACGACTCACTATAGGG]3´
Room Temperature
SDS
Documents

For Research Use Only. Not for use in diagnostic procedures.