missing translation for 'onlineSavingsMsg'
Learn More
  1. Home
  2. Products
  3. PCR Equipment and Supplies
  4. Oligonucleotides
  5. FERSO120

Thermo Scientific™ T3 promoter Sequencing Primer, 24-mer

Numéro de catalogue. FERSO120
Change view
Click to view available options
Quantity:
10 μM, 42 μL
1 product options available for selection
Product selection table with 1 available options. Use arrow keys to navigate and Enter or Space to select.
Numéro de catalogue. Quantity
FERSO120 10 μM, 42 μL
Use arrow keys to navigate between rows. Press Enter or Space to select a product option. 1 options available.
1 options
Numéro de catalogue. FERSO120 Fournisseur Thermo Scientific™ Code fournisseur SO120
Il en reste null

Description

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends.

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T3 RNA Polymerase promoter region and are supplied as 10 µM aqueous solutions.

Applications
• Sequencing of DNA fragments located downstream from the T3 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R (Cat. No. SD0141), pTZ57R, and pBluescript II

Promoter Sequence 5'-d (GCGCGAAATTAACCCTCACTAAAG)-3'

Related products
SP6 promoter Sequencing Primer, 18-mer (SO116)
T3 promoter Sequencing Primer, 17-mer (SO119)
SP6 promoter Sequencing Primer, 24-mer (SO117)
T7 promoter Sequencing Primer, 20-mer (SO118)

Notes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated

Spécifications

Promoter SP6, T3, T7
Product Type Sequencing Primer
Content And Storage T3 promoter Sequencing Primer, 24-mer, 10 μM (42 μL)

Store at –20°C.
Shipping Condition Dry Ice
Concentration 10 μM
Primer T3
Quantity 10 μM, 42 μL
For Use With (Application) Sequencing
Form Liquid

For Research Use Only. Not for use in diagnostic procedures.