missing translation for 'onlineSavingsMsg'
Learn More

Thermo Scientific™ SP6 promoter Sequencing Primer, 24-mer

Catalog No. FERSO117
Change view
Click to view available options
Quantity:
10 μM, 42 μL
1 product options available for selection
Product selection table with 1 available options. Use arrow keys to navigate and Enter or Space to select.
Catalog No. Quantity
FERSO117 10 μM, 42 μL
Use arrow keys to navigate between rows. Press Enter or Space to select a product option. 1 options available.
1 options
Catalog No. FERSO117 Supplier Thermo Scientific™ Supplier No. SO117
Only null left

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends.

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. This SP6 Promoter Sequencing Primer, 24-mer is complementary to the SP6 RNA Polymerase promoter region and is supplied as 10 μM aqueous solutions.

Applications
• Sequencing of DNA fragments located downstream from the SP6 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R (Cat. No. SD0141), pTZ57R, and pBluescript II

Promoter Sequence: 5'-d (CATACGATTTAGGTGACACTATAG)-3'

Related products
SP6 promoter Sequencing Primer, 18-mer (SO116)
T7 promoter Sequencing Primer, 20-mer (SO118)
T3 promoter Sequencing Primer, 17-mer (SO119)
T3 promoter Sequencing Primer, 24-mer (SO120)

Notes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated

Specifications

Promoter SP6, T3, T7
Product Type Sequencing Primer
Content And Storage SP6 promoter Sequencing Primer, 24-mer, 10 μM (42 μL)

Store at –20°C.
Shipping Condition Dry Ice
Concentration 10 μM
Primer SP6
Quantity 10 μM, 42 μL
Vector pTZ19R, pTZ57R, pBluescript II
For Use With (Application) Sequencing
Form Liquid

For Research Use Only. Not for use in diagnostic procedures.