missing translation for 'onlineSavingsMsg'
Learn More
Please login to your online account to display your discounted pricing

Thermo Scientific™ pJET1.2 Reverse Sequencing Primer, 24-mer

Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends.

Supplier:  Thermo Scientific™ SO511

Catalog No. FERSO511



Description

Description

Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.2 sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.2. All primers are supplied as 10 µM aqueous solutions.

Applications
• Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2p sequence
• Colony screening by PCR

pJET1.2 Primer sequences
• pJET1.2 forward sequencing primer, 23-mer: 5'-d(CGACTCACTATAGGGAGAGCGGC)-3'
• pJET1.2 reverse sequencing primer, 24-mer: 5'-d(AAGAACATCGATTTTCCATGGCAG)-3'

Related products
pJET1.2 Forward Sequencing Primer, 23-mer (Cat. No.SO501)

Specifications

Specifications

Forward Sequencing Primer
Dry Ice
pJET
pJET1.2
Liquid
pJET1.2 Forward Sequencing Primer, 23-mer, 10 μM (84 μL)

Store at –20°C.
10 μM
84 μL
Sequencing
SDS
Documents

Documents

Promotions

Promotions

For Research Use Only. Not for use in diagnostic procedures.