Learn More
Thermo Scientific™ pJET1.2 Forward Sequencing Primer, 23-mer
Description
Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.2 sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.2. All primers are supplied as 10 µM aqueous solutions.
Applications
• Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2p sequence
• Colony screening by PCR
pJET1.2 Primer sequences
• pJET1.2 forward sequencing primer, 23-mer: 5'-d(CGACTCACTATAGGGAGAGCGGC)-3'
• pJET1.2 reverse sequencing primer, 24-mer: 5'-d(AAGAACATCGATTTTCCATGGCAG)-3'
Related products
pJET1.2 Reverse Sequencing Primer, 24-mer (Cat. No. SO511)
Specifications
Specifications
| Product Type | Forward Sequencing Primer |
| Content And Storage | T3 promoter Sequencing Primer, 24-mer, 10 μM Store at –20°C. |
| Shipping Condition | Dry Ice |
| Concentration | 10 μM |
| Primer | pJET |
| Quantity | 10 μM |
| Vector | pJET1.2 |
| For Use With (Application) | Sequencing |
| Form | Liquid |
For Research Use Only. Not for use in diagnostic procedures.