missing translation for 'onlineSavingsMsg'
Learn More

Thermo Scientific™ pJET1.2 Forward Sequencing Primer, 23-mer

Catalog No. FERSO501
Change view
Click to view available options
Quantity:
10 μM
1 product options available for selection
Product selection table with 1 available options. Use arrow keys to navigate and Enter or Space to select.
Catalog No. Quantity
FERSO501 10 μM
Use arrow keys to navigate between rows. Press Enter or Space to select a product option. 1 options available.
1 options
Catalog No. FERSO501 Supplier Thermo Scientific™ Supplier No. SO501
Only null left

Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends.

Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.2 sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.2. All primers are supplied as 10 µM aqueous solutions.

Applications
• Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2p sequence
• Colony screening by PCR

pJET1.2 Primer sequences
• pJET1.2 forward sequencing primer, 23-mer: 5'-d(CGACTCACTATAGGGAGAGCGGC)-3'
• pJET1.2 reverse sequencing primer, 24-mer: 5'-d(AAGAACATCGATTTTCCATGGCAG)-3'

Related products
pJET1.2 Reverse Sequencing Primer, 24-mer (Cat. No. SO511)

Specifications

Product Type Forward Sequencing Primer
Content And Storage T3 promoter Sequencing Primer, 24-mer, 10 μM

Store at –20°C.
Shipping Condition Dry Ice
Concentration 10 μM
Primer pJET
Quantity 10 μM
Vector pJET1.2
For Use With (Application) Sequencing
Form Liquid

For Research Use Only. Not for use in diagnostic procedures.