missing translation for 'onlineSavingsMsg'
Learn More

Thermo Scientific™ M13/pUC Sequencing Primer (-46), 22-mer

Catalog No. FERSO114
Change view
Click to view available options
Quantity:
10 μM, 45 μL
1 product options available for selection
Product selection table with 1 available options. Use arrow keys to navigate and Enter or Space to select.
Catalog No. Quantity
FERSO114 10 μM, 45 μL
Use arrow keys to navigate between rows. Press Enter or Space to select a product option. 1 options available.
1 options
Catalog No. FERSO114 Supplier Thermo Scientific™ Supplier No. SO114
Only null left

Thermo Scientific M13/pUC Sequencing Primer (-46), 22-mer is a synthetic single-stranded 22-mer oligonucleotide with free 5'- and 3'-hydroxyl ends.

Thermo Scientific M13/pUC Sequencing Primer (-46), 22-mer is a synthetic single-stranded 22-mer oligonucleotide with free 5'- and 3'-hydroxyl ends. This M13/pUC primer anneals to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 μM aqueous solutions.

Applications
• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19 (Cat. No. SM0221), pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR

Primer Sequence: 5'-d(GCCAGGGTTTTCCCAGTCACGA)-3'

Specifications

Product Type Sequencing Primer
Content And Storage M13/pUC Sequencing Primer (-46), 22-mer, 10 μM (45 μL)

Store at –20°C.
Shipping Condition Dry Ice
Concentration 10 μM
Primer M13
Quantity 10 μM, 45 μL
Vector pUC19, pTZ19R, pTZ57R, M13mp18, pBluescript II
For Use With (Application) Sequencing
Form Liquid

For Research Use Only. Not for use in diagnostic procedures.