missing translation for 'onlineSavingsMsg'
Learn More
Please login to your online account to display your discounted pricing

Promega™ pUC/M13 Sequencing Primers DFS Item

Designed for sequencing inserts cloned into the M13 vectors and pUC plasmids. They also can be used for sequencing other lacZ-containing plasmids such as the pGEM-Z and pGEM-Zf Vectors.

Manufacturer:  Promega™ Q5601

 View more versions of this product

Catalog No. PR-Q5601



Specifications

Specifications

10μg/mL
Primer
CGCCAGGGTTTTCCCAGTCACGAC
For sequencing inserts cloned into the M13 vectors and pUC plasmids developed by messing
2μg
Documents