missing translation for 'onlineSavingsMsg'
Learn More
Please login to your online account to display your discounted pricing

Promega™ pUC/M13 Sequencing Primers DFS Item

Designed for sequencing inserts cloned into the M13 vectors and pUC plasmids developed by Messing

Manufacturer:  Promega™ Q5601

 View more versions of this product

Catalog No. PR-Q5601


 

Specifications Description & Specifications

Specifications

For sequencing inserts cloned into the M13 vectors and pUC plasmids developed by messing
CGCCAGGGTTTTCCCAGTCACGAC
2μg
10μg/mL
Primer
Promotions

Promotions

  • Purchase up to $1,000 in any combination of Promega™ reagents and receive an equivalent amount of complimentary Promega products of your choice. This is an NLSU exclusive offer. You must apply and qualify for the program to be eligible.

    06/30/18