Please login to your online account to display your discounted pricing

Promega™ pUC/M13 Sequencing Primers


Designed for sequencing inserts cloned into the M13 vectors and pUC plasmids developed by Messing

Manufacturer: promega™  Q5421

 View more versions of this product

Catalog No. PR-Q5421

  • / Each
 

Description & Specifications

Specifications

Sequence TCACACAGGAAACAGCTATGAC
For Use With (Application) For sequencing inserts cloned into the M13 vectors and pUC plasmids developed by messing
Product Type Primer
Quantity 2μg
Product Name Primer
Quantity 2μg
Concentration 10μg/mL
Concentration 10μg/mL