Please login to your online account to display your discounted pricing

Promega™ pUC/M13 Sequencing Primers


Designed for sequencing inserts cloned into the M13 vectors and pUC plasmids developed by Messing

Manufacturer: promega™  Q5421

 View more versions of this product

Catalog No. PR-Q5421

  • / Each
 

Description & Specifications

Specifications

Concentration 10μg/mL
For Use With (Application) For sequencing inserts cloned into the M13 vectors and pUC plasmids developed by messing
Product Type Primer
Quantity 2μg
Sequence TCACACAGGAAACAGCTATGAC

  • Can be used for sequencing other lacZ-containing plasmids such as the pGEM™-Z and pGEM-Zf Vectors
  • Cap P purified by gel electrophoresis or HPLC
  • Supplied in sterile water