missing translation for 'onlineSavingsMsg'
Learn More
Please login to your online account to display your discounted pricing

Promega™ pUC/M13 Sequencing Primers DFS Item

Designed for sequencing inserts cloned into the M13 vectors and pUC plasmids. They also can be used for sequencing other lacZ-containing plasmids such as the pGEM-Z and pGEM-Zf Vectors.

Manufacturer:  Promega™ Q5421

 View more versions of this product

Catalog No. PR-Q5421



Description

Description

  • Can be used for sequencing other lacZ-containing plasmids such as the pGEM™-Z and pGEM-Zf Vectors
  • Cap P purified by gel electrophoresis or HPLC
  • Supplied in sterile water

Specifications

Specifications

10μg/mL
Primer
TCACACAGGAAACAGCTATGAC
For sequencing inserts cloned into the M13 vectors and pUC plasmids developed by messing
2μg
−30 to −10°C
Documents
Promotions

Promotions