Please login to your online account to display your discounted pricing

Promega™ pUC/M13 Sequencing Primers DFS Item


Designed for sequencing inserts cloned into the M13 vectors and pUC plasmids developed by Messing

Manufacturer: promega™  Q5421

 View more versions of this product

Catalog No. PR-Q5421

  • / Each
 

Description & Specifications

Specifications

For Use With (Application) For sequencing inserts cloned into the M13 vectors and pUC plasmids developed by messing
Quantity 2μg
Sequence TCACACAGGAAACAGCTATGAC
Product Type Primer
Concentration 10μg/mL