missing translation for 'onlineSavingsMsg'
Learn More
Learn More
Please login to your online account to display your discounted pricing
Promega pUC/M13 Sequencing Primers 
Designed for sequencing inserts cloned into the M13 vectors and pUC plasmids. They also can be used for sequencing other lacZ-containing plasmids such as the pGEM-Z and pGEM-Zf Vectors.
Supplier: Promega Q5601
Description
- Designed for Sequencing Inserts Cloned into the M13 Vectors and pUC Plasmids
- Can sequence other lacZ-containing plasmids such as the pGEM(R)-Z and pGEM(R)-Zf Vectors
- Supplied at a concentration of 10μg/ml
Specifications
| 10μg/mL | |
| Primer | |
| CGCCAGGGTTTTCCCAGTCACGAC |
| For sequencing inserts cloned into the M13 vectors and pUC plasmids developed by messing | |
| 2 μg |