missing translation for 'onlineSavingsMsg'
Learn More
Please login to your online account to display your discounted pricing

Promega™ pUC/M13 Sequencing Primers DFS Item

Designed for sequencing inserts cloned into the M13 vectors and pUC plasmids developed by Messing

$112.34 - $112.34

Specifications

For Use With (Application) For sequencing inserts cloned into the M13 vectors and pUC plasmids developed by messing
View More Specs


Products ${productFamilyLength}
Catalog Number Mfr. No. Sequence Price Quantity  
Catalog Number Mfr. No. Sequence Price Quantity  
PR-Q5391 Promega™
Q5391
GTTTTCCCAGTCACGAC Each for $112.34
PR-Q5401 Promega™
Q5401
CAGGAAACAGCTATGAC Each for $112.34
PR-Q5421 Promega™
Q5421
TCACACAGGAAACAGCTATGAC Each for $112.34
PR-Q5601 Promega™
Q5601
CGCCAGGGTTTTCCCAGTCACGAC Each for $112.34
Specifications

Description

  • Can be used for sequencing other lacZ-containing plasmids such as the pGEM™-Z and pGEM-Zf Vectors
  • Cap P purified by gel electrophoresis or HPLC
  • Supplied in sterile water

Description & Specifications

Specifications

For sequencing inserts cloned into the M13 vectors and pUC plasmids developed by messing