Please login to your online account to display your discounted pricing

Promega™ pUC/M13 Sequencing Primers

Designed for sequencing inserts cloned into the M13 vectors and pUC plasmids developed by Messing

$109.14 - $109.14

Specifications

For Use With (Application) For sequencing inserts cloned into the M13 vectors and pUC plasmids developed by messing
View More Specs
Products
Catalog Number Mfr. No. Sequence Price Quantity    

PR-Q5391

 
promega™
Q5391
GTTTTCCCAGTCACGAC Each for $109.14

PR-Q5401

 
promega™
Q5401
CAGGAAACAGCTATGAC Each for $109.14

PR-Q5421

 
promega™
Q5421
TCACACAGGAAACAGCTATGAC Each for $109.14

PR-Q5601

 
promega™
Q5601
CGCCAGGGTTTTCCCAGTCACGAC Each for $109.14
Description & Specifications

Specifications

For Use With (Application) For sequencing inserts cloned into the M13 vectors and pUC plasmids developed by messing

  • Can be used for sequencing other lacZ-containing plasmids such as the pGEM™-Z and pGEM-Zf Vectors
  • Cap P purified by gel electrophoresis or HPLC
  • Supplied in sterile water