Please login to your online account to display your discounted pricing

GE Healthcare Dharmacon miRIDIAN™ microRNA Mimic Negative Controls


Manufacturer: ge healthcare dharmacon  CN-001000-01-05

 View more versions of this product

Catalog No. CN10000105

  • / Each
 

Description & Specifications

Specifications

For Use With (Application) Non-targeting inhibitors for use as controls in miRNA inhibition experiments, distinguish between specific inhibitor activity and background effects
Quantity 5nm

We offer two universal negative controls for both inhibitors and mimics that are based on the sequences of two miRNAs in C. elegans.

These miRNAs have been confirmed to have minimal sequence identity with miRNAs in human, mouse and rat. We recommend using the mature sequence information to determine which control would be most appropriate for the miRNA being studied.

  • Negative control sequence based on cel-miR-67, mature sequence: UCACAACCUCCUAGAAAGAGUAGA and Accession Number: MIMAT0000039
  • Cel-miR-67 has been confirmed to have minimal sequence identity with miRNAs in human, mouse and rat